Northern blotting depends on the phenomenon of the binding of a labeled DNA segment to an mRNA.
Question:
Northern blotting depends on the phenomenon of the binding of a labeled DNA segment to an mRNA. Explain why this binding occurs.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (QA)
The statement in the question about Northern blotting using a labeled DNA segment to bind to mRNA is ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Question Posted:
Students also viewed these Sciences questions
-
Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...
-
Chapter 20 describes a blotting method known as Northern blotting, which can be used to detect RNA transcribed from a particular gene or a particular operon. In this method, a specific RNA is...
-
Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 20, Northern blotting...
-
Casey Motors recently reported the following information: Net income = $850,000. Tax rate = 40%. Interest expense = $200,000. Total investor-supplied operating capital employed = $9 million. ...
-
Refer to the accompanying figure showing surge protectors p and q used to protect an expensive television. If there is a surge in the voltage, the surge protector reduces it to a safe level. Assume...
-
Starz Department Store is located near the Towne Shopping Mall. At the end of the companys calendar year on December 31, 2020, the following accounts appeared in two of its trial balances....
-
What are different classes of cast iron? What are their properties and applications?
-
An analysis of the transactions of Cavernous Homes Inc. yields the following totals at December 31, 2011: cash, $3,200; accounts receivable, $4,500; notes payable, $5,000; supplies, $8,100; common...
-
Write the equation of the line with a slope of -2 and a y-intercept of 3 .
-
In Northern and Western blotting, what is the purpose of gel electrophoresis?
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
It is known that the possible values for the magnetic quantum number m, are -4, -3, -2, -1, 0, +1, +2, +3, and +4. Determine the orbital quantum number l and the smallest possible value of the...
-
A CPA's engagement letter for the audit of a privately owned bank includes an indemnification clause limiting the liability of the CPA in the event that losses occur due to a knowing...
-
How do you lead and advise 2 case workers on a complex case including: 1. Providing direction , support and recommendations and advise 2. Promoting best practice 3. Monitoring case progress Worker 1...
-
how does the calculated slope reflect what we see on the graph? Dollars $3,500,000,000 $3,000,000,000 $2,500,000,000 $2,000,000,000 $1,500,000,000 $1,000,000,000 $500,000,000 $- Mayo y=-5213.3x +...
-
What information do you think you might be missing to determine the correct valuation?
-
The price of eggs hat been increasing 4% per year. If the cost of a dozen is now 28.60 , when will the cost of eggs be 40.00 ?
-
Two loudspeakers, A and B (Fig. 16.40), are driven by the same amplifier and emit sinusoidal waves in phase. Speaker B is 2.00 m to the right of speaker A. Consider point Q along the extension of the...
-
Give an example of transitory income. What effect does this income have on the marginal propensity to consume?
-
Social Media Marketing Are You LinkedIn? Did you know networking is still the most effective way to find a job? Some individuals wait to use LinkedIn until they graduate or are looking for a job....
-
Make up an advertisement about a water bottle that uses at least two of the three methods of persuasion (pathos, logos, ethos) and uses demographics to appeal to a specified target audience. Then...
-
Audit the channel functions by using the efficiency template which involves evaluating the effectiveness of a company's marketing and sales channels using a set of criteria that focus on efficiency....
Study smarter with the SolutionInn App