In a 2011 survey, 58% of American adults said they use the Internet. If 20 American adults

Question:

In a 2011 survey, 58% of American adults said they use the Internet. If 20 American adults are selected at random, find the probability that exactly 12 will say they use the Internet.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Elementary Statistics A Step By Step Approach

ISBN: 9780077665807

9th Edition

Authors: Allan G. Bluman

See More Books

Question Posted: Jul 27, 2022 04:09 AM

See More Questions

In a sample of 2016 U.S. adults, 242 said Richard Nixon was the worst president since World War II. Three U.S. adults are selected at random without replacement. (a) Find the probability that all...
In a sample of 1000 U.S. adults, 150 said they are very confident in the nutritional information on restaurant menus. Four U.S. adults are selected at random without replacement. (a) Find the...
In a sample of 2016 U.S. adults, 383 said Franklin Roosevelt was the best president since World War II. Two U.S. adults are selected at random without replacement. (a) Find the probability that both...
Problem 4.2 Ask the user to enter his/her age, with the prompt: "How old are you? Please enter your age as a number between 0 and 120. -> ". Check that what was entered is a number between 0 and 120....
Discuss what you consider to be the three most important advantages for the use of a DBMS for a company like Dream Home and provide a justification for your selection. Discuss what you consider to be...
A circular post, a rectangular post, and a post of cruciform cross section are each compressed by loads that produce a resultant force P acting at the edge of the cross section (see figure). The...
The probability that a wafer contains a large particle of contamination is 0.01. If it is assumed that the wafers are independent, what is the probability that exactly 125 wafers need to be analyzed...
Enterprise Industries produces Fresh, a brand of liquid laundry detergent. In order to study the relationship between price and demand for the large bottle of Fresh, the company has gathered data...
Assignment 4 In this assignment you are provided information on an experiment and you are required to investigate and interpret the output which is provided below. Problem: Consider the...
Tony and Suzie graduate from college in May 2024 and begin developing their new business. They begin by offering clinics for basic outdoor activities such as mountain biking or kayaking. Upon...
Sports Scores Hot Line receives, on the average, 8 calls per hour requesting the latest sports scores. The distribution is Poisson in nature. For any randomly selected hour, find the probability that...
If 8% of the population of trees are elm trees, find the probability that in a sample of 100 trees, there are exactly 6 elm trees. Assume the distribution is approximately Poisson.
Murphey Dental Company manufactures dental instruments. The company's product line includes products as simple as dental picks and products as complex as panoramic x-ray machines. Mace Edison, a...
Nova Company s total overhead cost at various levels of activity are presented below: Month Machine - Hours Total Overhead Cost April 5 3 , 0 0 0 $ 2 1 4 , 4 3 0 May 4 3 , 0 0 0 $ 1 9 0 , 3 3 0 June...
Beginning Accounts Receivable is $ 4 9 0 0 , ending Accounts Receivable is $ 3 9 0 0 , Interest Revenue on the income statement is $ 3 7 0 0 , beginning Interest Receivable is $ 5 5 0 , ending...
Liquidity management is critical for financial institutions (or any other organizations) to meet their financial obligations. Liquidity risk arises when the organization fails to obtain funds....
Motors has a total debt of of 682,400 and a debt equity ratio of 6.5% what is the value of the total assets? How it can be determined give all step by step solution for this question.
What is financial management? What are the types of financial management. Explain each type with example.
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand of the E. coli tRNATyr promoter shown below. 5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3...
With your classmates, form small teams of skunkworks. Your task is to identify an innovation that you think would benefit your school, college, or university, and to outline an action plan for...
Find the z value that corresponds to the given area. 0.4066
Find the z value to the right of the mean so that a. 54.78% of the area under the distribution curve lies to the left of it. b. 69.85% of the area under the distribution curve lies to the left of it....
Find the z value to the left of the mean so that a. 98.87% of the area under the distribution curve lies to the right of it. b. 82.12% of the area under the distribution curve lies to the right of...
Company ABC recently sold CAD 10,000,000 worth of products to one of its Canadian customers and is expected to receive the payment in CAD in 30 days. Your management team would like to try out...
Suppose that $24,000 is invested at a rate of 5% interest compounded monthly. Determine how much the investment is worth after 10 years.
Your firm has a large liability associated with an infrastructure project that has a duration of 2.5 years. You currently have the funds required for that liability invested in government bonds with...

In a 2011 survey, 58% of American adults said they use the Internet. If 20 American adults

Question:

Step by Step Answer:

Elementary Statistics A Step By Step Approach

Students also viewed these Statistics questions