Below is a diagram showing the template strands of a chromosome that will soon be replicated....
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand. Below is a diagram showing the template strands of a chromosome that will soon be replicated. The end of the chromosome shown on the right is the actual end of the Some useful information: "or" is the origin of replication "strand A" and "strand B" are referring to the template strands for replication to the right of the origin of replication (you'll have to use your imagination to picture the soon-to-be-replicated new strands) strand A ori 3-end 15-end strand B For each question below select from the options in A through D and then explain: (A) if the word or phrase is associated with strand A only (B) if the word or phrase is associated with strand B only (C) if the word or phrase is associated with strand A and B (D) if the word or phrase is associated with neither strand A nor B (1) Replication of this strand involves a single primer molecule. (ii) Replication of this strand involves several primer molecules. (iii) Replication of this strand does not need primer. (vi) This strand is the leading strand template. (v) This strand is the lagging strand template and thus Okazaki fragments are made using this strand as a template. (vi) The regular DNA replication machinery of the cell cannot prevent the shortening of this strand during successive replication cycles. (vii) The DNA polymerase moves in the 3' to 5' direction on the template strand of this strand.
Expert Answer:
Answer rating: 100% (QA)
Strand A Lagging strand Strand B Leading strand Explanation The DNA strands ends are presented on the right side of the diagram and the dotted line on ... View the full answer
Related Book For
Fundamentals of biochemistry Life at the Molecular Level
ISBN: 978-0470547847
4th edition
Authors: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Posted Date:
Students also viewed these accounting questions
-
Below is a diagram showing the synthesis and breakdown of glycogen [(glucose)]. Fill in the blanks and identify the enzyme that catalyzes each numbered reaction. fructose-6-P glucose - UDP UTP 3...
-
Make a diagram showing the three primary (embryonic) brain vesicles. Name each and then use clinical terminology to name the resulting adult brain regions.
-
Below is a diagram of the servo system that controls the position of the cutting tool in a machine tool. is seen. The constants of the system are K = Kp.Ka.Km = 360N / m, M = 10kg and B = 80N / (m /...
-
Find the maximum value of (x, y, z) = x a y b z c for x, y, z 0 on the unit sphere, where a, b, c > 0 are constants.
-
Sow Tire, Inc., has sales of $1,450,000 and cost of goods sold of $980,000. The firm had a beginning inventory of $97,000 and an ending inventory of $82,000. What is the length of the days sales in...
-
If a portfolio had a return of 8%, the risk free asset return was 3%, and the standard deviation of the portfolio's excess returns was 20%, calculate the Sharpe measure.
-
Draw a cash flow diagram of any investment that exhibits both of the following properties: 1. The investment has a 4-year life. 2. The investment has a 10 percent/year internal rate of return.
-
(Entries and Questions for Bond Transactions) On June 30, 2010, Mackes Company issued $5,000,000 face value of 13%, 20-year bonds at $5,376,150, a yield of 12%. Mackes uses the effective-interest...
-
Find the missing side lengths (in kilometers). (The sketches are not to scale.) 33 km 24 km 48 89 x 15 km 48% 89 22 km X = y = km E E km
-
Laval produces lighting fixtures. Budgeted Information for Its two production departments follows. The departments use machine hours (MH) and direct labor hours (DLH). Overhead cost Direct labor...
-
Exercise C: Practice with null-terminated strings Read This First As explained in lectures, a string in C is a sequence of character codes stored in an array of char elements, with a '\0' marking the...
-
If 38 hours per week are the normal hours, what is the total hours paid for each of the following? a b d e f Normal + 1 hour overtime @ 12/ Normal + 5 hours overtime @ 1-1/2 Normal +42 hours overtime...
-
Comment on the suggestion that planning a career is as important today as it has ever been.
-
Distinguish between pressure and stress in an organizational context.
-
Explain what is meant by postmodernism in connection with organizational theory.
-
Compare and contrast the functional grouping with that of matrix organization.
-
Discount rate of 12% Annuity 1: - 6 monthly payments - The 1st payment is $200, starts immediately, and grow at 0.5% per month. Annuity 2: - pay $600 every quarter for 2 quarters Question - What type...
-
Three forces with magnitudes of 70pounds, 40 pounds, and 60 pounds act on an object at angles of 30, 45, and 135, respectively, with the positive x-axis. Find the direction and magnitude of the...
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
A eukaryotic ribosome contains four different rRNA molecules and ~ 82 different proteins. Why does a cell contain many more copies of the rRNA genes than the ribosomal protein genes?
-
What is the advantage of hormones activating a lipase to stimulate nonshivering thermogenesis in brown fat rather than activating UCP1 directly?
-
Consider a strictly risk averse agent endowed with initial wealth \(w_{0}\) and with a strictly increasing and twice differentiable utility function. Let \(r_{f}\) and \(\tilde{r}\) denote the return...
-
Consider a quadratic utility function \(u(x)=x-\frac{b}{2} x^{2}\), an initial wealth \(w_{0}=100\), a risk free rate \(r_{f}=1.1\) and a risky asset with expected return...
-
Consider the optimal portfolio choice problem in the presence of \(N\) risky assets with returns \(\left(\tilde{r}_{1}, \ldots, \tilde{r}_{N} ight)\) and of a risk free asset with return \(r_{f}>0\)....
Study smarter with the SolutionInn App