S
  1. study help
  2. subject categories
  3. computer science
  4. databases
  5. march 2019
  6. 06

Databases Questions and Answers March 06, 2019

Expert-verified solutions to help you succeed

I need help with java please! this comes from building java programs, back to basics fourth edition. The main goal is to produce a program that will strip all HTML tags from files inputted without using the string class method replaceAll() Chapter 6: Exercise #12, page 437 Specific instruction: This problem will require you to process lines from

Instructions: The UML diagram below describes a class named Movie. Implement this class in Java and test it from a main method that creates several Movie objects. The printDescription ( ) method should output all member variables for the class. The word " in " means the parameter is used to deliver data to the method.Note: No user input is
image text in transcribed

a) Legacy systems are older systems that rely on languages and technology that are no longer used for new systems development. Your client is using an outdated legacy system for human resources and asset management with some functions are still in good operation. As a business analyst, you need to advice your client what they can do for their
image text in transcribed

25 A) Write down the rules for naming the python variables 12 Marks Define operator Explain all the relational and logical operator with an example for each operator 15 Macho B
image text in transcribed

p PLEASE HELP ME HOW TO WRITE THIS BASH SCRIPT. PLESE EXPLAIN WITH DETAILS. .A DNA string is a sequence of the letters a, c, g, and t in any order, whose length is a multiple of 3. For example, aacgtttgtaaccagaactgt is a DNA string of length 21. Each letter is called a base, and a sequence of three conse cutive letters is called a codon. For
image text in transcribed

Which of the following is not a type of Operating System? A . Real - Time Operating System ( RTOS ) B . Network Operating System ( NOS ) C . Distributed Operating System D . Wireless Operating System

#3 Q3: Which of the following option is NOT correct about program language categories? (a) Functional and Imperative programs follow Logic or Rule that are specified in no particular order (b) Functional program are based on making computations by applying functions to given parameters (e) Central features in imperative programs are variables,
image text in transcribed

QUESTION 2 3 In the Intel 8 0 8 6 8 0 8 8 microprocessor, 8 pins of the address bus are also shared with the data bus. True False QUESTION 2 4 In the Intel 8 0 8 6 / 8 0 8 8 microprocessor, given the program MOV AL , 0 1 FF MOV BX , AL The result of the program will be stored: a . In the BX register b . In the AL register c . In the DS register d
image text in transcribed

Given that x is an array such that: x = [ 1 , 3 , 5 , 7 , 9 ] ; what is the result of disp ( x ( 3 ) ) ? 3 2 1 3 5 7 9 5
image text in transcribed

Which is the correct statement to print the value of variable B? int A = 100; float B = 510.5, C = 20.75; O a. printf(" Value of B= %f", B); O b. printf(" Value of B=%s" B); O c printf(" Value of B = %c, B); O d. printf(" Value of B=%d. B)
image text in transcribed

Suppose Alice wants to send a message M with a digital signature Sig(M) to Bob. Alice and Bob have an authentic copy of each other's public keys, and have agreed on using a specific hash function h. Apply both the digital signature and hash algorithm and develop the steps that Alice must follow when signing M, and the steps that recipient Bob must
image text in transcribed

need html/php codes 2. Continue to the second part of survey in the second page as below.(10%) Survey - continue Which assignments have you completed? HWI: echo and css HW2: Form to PHP HW3: Temary Operator HW4: Loop about course checklist HWS: Find the highest score out of ten scores HW6: Connection between form and server HW7: Multiplication
image text in transcribedimage text in transcribed

Question 1 What is the combined sum of all attack vectors in a corporate network? 1 point The Access Control List ( ACL ) The attack surface The antivirus software The risk

6. (a) Each clock cycle, an input is provided to the finite state machine (FSM) below. Assuming that we start at state 00 and given an input for each tick, fill in the table to show the next state. (b) What bit sequence(s) does this FSM recognize? Your answer should be a string of bits (ex. 01 or 1110). 11 0- 10 00 01 Time 0 1 2 3 4 5 6 input
image text in transcribed

Many supermarkets use loyalty or discount cards to keep track of who buys which items. How can graphs be used to model this relationship? Should the edges be directed or undirected? Should multiple edges be allowed? Should loops be allowed? Does this graph have any special properties? Question 3 options: Undirected graph Digraph Multiple edges

Country X and Country Y have a deteriorating relationship due to concerns over covert cyber attacks. Attribution is very difficult in these situations; however Country Y has observed known tactics, techniques, and procedures of Country X in these attacks. The issue is that the origin of the attacks seem to be occurring from outside of Country X .

Scenarios play an important role in architecture development. a . We initially identify appropriate scenarios by identifying use cases. Why does this approach usually result in a more complete set of scenarios than simply making a bulleted list of requirements? b . List three scenarios for CTAS. List the stakeholder who would support each
image text in transcribed

Q8.1: A bus-organized CPU similar to Fig. 8-2 has 16 registers with 32 bits in each, an 1.0 ALU, and a destination decoder. How many multiplexers are there In the A bus, and what is the size of each .a multiplexer? How many selection Inputs are needed for MUX A and MUX 8? How many inputs and outputs are there in the decoder? How many inputs and
image text in transcribedimage text in transcribed

Relational databases organize data into two - dimensional tables ( called relations ) with columns and rows. Each table contains data about an entity and its attributes. Group of answer choices True False

? ? ? ? ? ? ? i s a n a p p l i c a t i o n t h a t y o u r e n t o v e r t h e o p e n i n t e r n e t .

Prognosis Inc. owns a brain - computer interface that enables physicians to diagnose and treat some diseases quickly and accurately. Federal copyright protection extends to a . all of the choices. b . the general appearance of the app. c . the command structure of the app. d . the parts of the app that can be read by computers.

//PLEASE HELP ME MAKE MY PROGRAM READ THE LAST CODE(VOID AVAILABLE), ALSO CAN YOU FIX THE INFINITE LINE IN SOME OF THE CODES WHEN YOU PUT THE INFORMATION NEEDED? //thanks in advance // the code #include #include #include #include using namespace std; struct devicedata { string device_name; float quantity; char price; int stock; string pname; };
image text in transcribed

Linear page table * Assume a 32-bit processor, with pages of 4 KiB. We use a linear page table, and each PTE of the page table takes 4 bytes. Now, assume that a process uses two contiguous segment of 16 KiB, separated by an empty area of 8 MiB. How much much space would the page table take total, in bytes? *(you have to write a precise number)*
image text in transcribedimage text in transcribed

Question 16 $0.5$ Points The grouped frequency table below shows the frequency distribution of the age of drivers who were given a ticket. \begin{tabular}{cirl \hline Age at Incident & Frequency \hline 15 to 19 & 106 W \hline 20 to 24 & 49 \hline 25 to 29 & 25 \hline 30 to 34 & 6 W \hline 35 to 39 & 5 W \hline 40 to 44 & 5 W \hline \end{tabular?
image text in transcribed

Python Question 4 3 pts Which of the following statements about the following for loop are TRUE? (Check all that apply) for i in range(12): First time through the loop, the variable i contains value 1 Function range generates a sequence of numbers This loop repeats 11 times Last time through the loop, the variable i contains value 11
image text in transcribed

Please show all steps in solving parts a, b, and c. Please code the short program in the Bonus Section (bottom paragraph) in Java with comments. Thanks! For six points. For full credit, show your work. Don't just use Wolfram Alpha. Suppose you have algorithms with the three running times listed below. (Assume these are the exact number of
image text in transcribed

3. Let = { a,b,c). Using the systematic method described in class and textbook convert the following nondeterministic state transition diagram into a deterministic transition diagram: Describe how the deterministic transition diagram is obtained from the nondeterministic one as follows: label the states of the deterministic diagram by sets of
image text in transcribed

Study the definitions of function "get" and answer the question below Note: ASCII Code for A='65',B='6 6',H='72', a='9 7', h='104' int get (int x, char y, double z) if ( (x y) > 0) return( (static cast int> (y) - 65)); else return(y + x); double get (double x, int z, char y) { return( static_cast int>(y)); char get (char x, int y, double z) x =
image text in transcribed

1. Do research on Database, explain it in 2 examples? 2. Explain how an organizations uses database in their information systems, Talk about any organization as an example? 3. Currently, all organizations uses big data in their information systems, Explain how an organization uses it and why? 4. Do research on the Web to identify three large Big

As a student from Computer Systems & Information Technology department, your task is to think about a topic of your choice for your possible final year project.But the topic is only from computer science subject. (10 points) Write in your own words TASK 1 Give a title to your final year project. Task 2 : (50 points) Prepare a project proposal no

2. The program will repeatedly prompt the user to enter the following four items for a given customer (in the specified order): a. The customer's classification code (a character) b. The number of days the vehicle was rented (an integer) c. The vehicle's odometer reading at the start of the rental period (an integer) d. The vehicle's odometer
image text in transcribedimage text in transcribedimage text in transcribed

Prolog program Write programs to generate the next higher permutation of a list of positive integers, in two ways: By applying the following definition of the problem: Permutation LI is the next, higher permutation of L if L1 is a higher permutation of L and LI is not far higher than L. L1 is a higher permutation of L if it is a permutation of L
image text in transcribed

a ) write the algorithm b ) Briefly explain why the algorithm solves the problem, and the correctness c ) State and briefly explain the running time of your algorithmYou are given a strongly connected directed graph G = ( V , E ) with positive edge weights / lengths along with a particular node v * * inV. Give an efficient algorithm for finding
image text in transcribed

REALTOR ASSIST C++ A realtor friend of mine could use a program that would allow her to keep track of real estate property listings. Here are the main features of the program 1) New Property The realtor uses this feature to add a new property listing to the program. For each property, the program should ask for the property number (a number

A write a command that will suspend your vim editing session. On the line following the command list the vim modes (normal, insert, etc.) where the command can be entered. B write a command that will put your suspended vim editing session from Question 3 into background mode. On the line following the command insert the output of the command. C

Cannot use chol command. Must use method such as: sum = 0; for j = 1:i+1 sum = sum + ...... Write a computer program that computes the Choleski factorization of a symmetric square matrix. The program should issue an error message if the matrix is not positive definite. Test the program this way (if the program is written in Matlab) M=rand(5);
image text in transcribed

Use Euler's method in Python to generate an approximation in the interval tin [ 0 , 1 ] to the solution of the following initial value problem, using 5 steps to go from t = 0 to t = 1 . d y d t = 4 t 5 - y , y ( 0 ) = 3 . Here's what it looks like. Observe that each Euler step uses the slope at its starting point. Enter your answers as comma -
image text in transcribed

data structure JAVA LANGUAGE Using the classes and methods implemented in the Lab OR the code posted on Moodle where class Node includes four instance variables: public int iData; // data item (key) public double dData; // data item public Node leftChild; // this node's left child public Node rightChild; // this node's right child class BST_Tree
image text in transcribed

Binary Bomb Phase-6 0x0000000000400f9b : push %r13 0x0000000000400f9d : push %r12 0x0000000000400f9f : push %rbp 0x0000000000400fa0 : push %rbx 0x0000000000400fa1 : sub $0x58,%rsp 0x0000000000400fa5 : lea 0x30(%rsp),%rsi 0x0000000000400faa : call 0x4012d9 0x0000000000400faf : lea 0x30(%rsp),%r12 0x0000000000400fb4 : mov $0x0,%r13d

Answer all the questions: B1. Given the following classes, answer the below questions. Person (abstract class) that has the following: Data Fields: private String name, private String address Constructor: Constructor to create a Person object with specified name and address. Methods: Accessor and mutator methods for all data fields. Student

(b) Develop a program to decode the nominal value of a resistor. Use the information in Figure 1 to figure out the nominal value of a standard resistor. 470 45% tolerance 10 10 1% 10- 19 20 digit digit black O brown 11 red 2 2 orange 3 3 yellow 4 4 green 5 5 blue 6 violet 7 gray 8 8 white 9 9 gold silver no color 10 100 10 10% 0.5% 0.25% 0.1%
image text in transcribed

The open-file table is used to maintain information about files that are currently open. Should the operating system maintain a separate table for each user or maintain just one table that contains references to files that are currently being accessed by all users? If the same file is being accessed by two different programs or users, should there
image text in transcribed

Computer engineering digital systems A digital comparator takes two 2-bit operands (A: a_1a_0 & B: b_1b_0), compares them and generates three single-bit outputs, A>B, A=B, and A
image text in transcribed

User For this question consider the following facts gcd ( x , 0 ) = x , for all x > = 0 ( 1 ) gcd ( 0 , y ) = y , for all y > = 0 ( 2 ) gcd ( x , y ) = gcd ( x , y + kx ) = gcd ( x + ky , y ) , for all x , y , k > = 0 ( 3 ) x = x ( xdivy ) + xmody, for all x > = 0 , y > 0 ( 4 ) Complete the following proof outline { true } a : = A b : = B while a

Q1. When we pull cable we number the cable in consecutive order. Please describe. Q2. Describe 110 block labels. Q3. How we label 48 port Patch Panel Q4. How we label bus bars, TRs, Face Plates Q5. Give example of labeling Face Plate Q6. How do you do Labeling, when installing new cable to existing system. Q7. What are different types of labeling
image text in transcribed

1. Create a new Java project using the IDE of your choice. Call the project and main class 2. The class GreetingGenerator java should contain a main method with the header 3. Right-click on the projet to create a new class. Call the new class PrintGreeting. Note that this GreetingGenerator. public static void main(String args). We'll come back to
image text in transcribed

Applying state reduction with a minimum number of states on the following state fable results in: \begin{tabular}{c|11|11] Present State & \multicolumn{2}{c}{Next state } & \multicolumn{3}{c}{ Output } & $\mathrm{x}=0$ & $\mathrm{x}=1$ & $\mathrm{x}=0$ & $\mathrm{x}=1$ \hline $\mathrm{a} $ & $\mathrm{d}$ & $\mathrm{b}$ & 0& ON $\mathrm{-b} $ &
image text in transcribed

I need someone proficient in Microsoft SQL Server to assist me in writing some queries that REQUIRE JOINING TABLES based on the following set of tables and requirements below: Feel free to submit a partial answer, I just need help solving whatever you can! Thank you for your time tblAddress AddressID tblCompany CompanylD CompanyName
image text in transcribedimage text in transcribedimage text in transcribed

What are the data elements associated with an entity? Entities Keys Attributes Metadata
image text in transcribed

Design a program: Build a flowchart and a pseudo-code for each of the following questions: Input an ID Number, 3 test grades and a final grade. Each test is worth 20% of the final grade and the final is worth 40%. Calculate the Final Average and print out the ID number and the final average. Design a program that will obtain from the user a length

[Python]Write a GUI class Game that implements a number guessing game. The GUI should start by choosing a random number between 1 and 100 (using a function from the random module) and then opening up a GUI which allows the user to enter number guesses: The GUI has an Entry widget for the user to type the number guess and a Button widget labeled
image text in transcribed

The Fort Bend County Basketball Conference (FBCBC) is an amateur basketball association. Each city in the county has one team as its representative. Each team has a maximum of 12 players and a minimum of 9 players. Each team also has up to three coaches (offensive, defensive, and physical training, coaches). During the season, each team plays two
image text in transcribed

I need help to write a k-means clustering algorithm in C++ that reads data from an input.txt file that has 2 columns with integer values. input.txt This program should output a file called output.txt with the following results shown below. 297 116 268 142 522 286 468 308 297 116 1 268 142 1 522 286 2 468 308 2
image text in transcribedimage text in transcribed

Assume a square wave named X is approximated by its first 4 frequency components; the resulting wave is named Y . Assuming the fundamental frequency of Y is 2 . 5 MHz , compute the following: a ) the spectrum of Y b ) the bandwidth of Y c ) the data rate of Y Q 1 : Please provide your calculation steps ( when possible ) as well as the final answer.

Data structure and Algorithm (CSC 112). Question: Write C/C++ code to maintain record of automobile using linked list. - A single record contains: 1. Make e.g. Honda, Corolla, Suzuki (max 10 characters). 2. Model, e.g. 2023, 1990, 2020 etc. 3. Engine size in liters, e.g. 1.3, 1.0, 0.7 etc. 4. Name of owner, e.g. Talha, Zubair (max 10 characters).
image text in transcribed

1. Show the IEEE single-precision encoding of binary +1110.011. 2. Convert the fraction 5/8 to a binary real. 3. Convert the fraction 17/32 to a binary real. 4. Convert the decimal value +10.75 to IEEE single-precision real. 5. Convert the decimal value -76.0625 to IEEE single-precision real
image text in transcribed

(Question 3/5 points). Suppose two fuzzy sets A and B are given: A=0.0/35 + 10 / 40 + 0.0745 B -0.042 + 1.0/50 +0.0/58 What are the memberships of y, (x) and (x) for the elements 37 and 44 in the sets A and B
image text in transcribed

1. Prove the sum of geometric series. 2. Prove the sum of arithmetic series. 3. Using math induction to prove above again. 1 (0
image text in transcribed

8. The graph coloring problem is the problem of finding the small- est number of colors such that when each vertex is assigned a color, no two adjacent vertices have the same color. Any graph can be greedily colored in the following way. Denote the colors by 1,2,3,.... Process the vertices in any order and assign to each vertex the smallest color
image text in transcribedimage text in transcribed

An Access view that displays the underlying view of an object. A . Design B . Field C . Outline
image text in transcribed

Lab Description Generate a Fibonacci sequence. Each number in the Fibonacci sequence is the sum of the two preceding numbers in the sequence. The first two numbers in the sequence are both 1. The third number is 2 the fourth number is 3, the ifth number is 5, and the sixth number is 8. The program should be able to return a specified number in the
image text in transcribedimage text in transcribedimage text in transcribed

True or False: The only way to set & update project variables is to go to the project variable page and edit it . False, variables can be set and updated via steps in scenarios or code and be fully automated. True, it is a manual operation.

Consider the following output from trace route: traceroute to thestar.com (65.8.49.78), 30 hops max, 60 byte packets 1 vlan490-router.net.mcmaster.ca (130.113.68.5) 1.872ms2.187ms2.319ms 2 itb-svi-core.net.mcmaster.ca (172.26.20.190) 0.403ms0.399ms0.378ms 3 campus-border.net.mcmaster.ca (130.113.69.4) 4.001ms4.053ms3.964ms
image text in transcribedimage text in transcribed

Write a Java program that prompts the user for and accepts as input a 5-digit integer value. The program should then calculate and print the sum of the individual digits of the number. For example, if the user inputs "53291", your program should add together the individual digits of the number and then print "20 as their sum. If the user inputs
image text in transcribed

Hot Dog Stand Exercise Instructions: Create a complete Java Program that meets the following requirements. You operate several hot dog stands distributed throughout town. Define a class named HotDogStand that has an instance variable for ( 1 ) the hot dog stand's ID number and an instance variable for ( 2 ) how many hot dogs the stand has sold
image text in transcribed

EN - US Bellevue Bank and Trust has recently purchased and deployed the Shuffle Cloud SOAR service and wants to take advantage of the functionality to automate as many of the tasks that the SOC and IR teams currently handle manually as possible. While there are tens or hundreds of use cases, the CISO at BB&T wants the team to pick two of the use

Consider a file system on a disk that has both logical and physical block sizes of 512 bytes. Assume that the information about each file is already in memory. For each of the three allocation strategies (contiguous, linked, and indexed), answer the following question: If we are currently at logical block 10 (the last block accessed was block 10)
image text in transcribed

HELP PLEASE! The probability that the item IS NOT in the array is 41. If the item is in the array, the probability that the last item in the array matches the search key is 81. The probability that the next to the last item of the array matches the search key is 51. The probabilities matching any of the remaining items are all equal. 1. ( 0.8
image text in transcribed

Q 1 0 0 . The height above my house can be described by the function a ) use the meshc ( ) and for the contour ( ) Functions in MatLab to vizualise H ( x , y ) for - 3 = ( x , y ) = 3 b ) you are given that when there is heavy rain, the sea will rise up to H ( x , y ) = 1 5 . use the contour ( ) funtion in MATLAB to plot this perimeter of the sea
image text in transcribed

3. Show step by step snapshot of binary search tree after successively inserting keys 1,8,7, 6, 5,4, 3, 2 into an initially empty tree. (10 points)
image text in transcribed

Purpose: To write a VHDL code for a simple 4-bit BCD counter To write a VHDL code for a seven segment decoder To write a vhdl code to tie the designs above to update and display a count from 00 to 59. To synthesize, implement, program and test the design on the ALTERA Cyclone IVE chip Equipment: PC with ALTERA Quartus II Tools, DE2-115 board.

(c) In the distributed pub/sub system is shown below, nodes p and s represent publisher and subscriber respectively. Given the subscriptions construct the routing tables for node 1, 2 and 3 respectively. In addition, show the message travelling path(s) from publisher to subscriber(s) in the follow scenarios. [12] i. x = 30 is published to node 1.
image text in transcribed

Consider the ER diagram illustrated in the following figure. Convert the ER diagram to relations and write SQL DDL statements for creating the tables for those relations. Pick suitable data types for each attribute. For string attributes pick reasonable lengths. Include the appropriate constraints ( domain , primary key, foreign key, UNIQUE, and
image text in transcribed

Suppose that you are working with CISC machine using a 2.3 GHz clock (i.e., the clock ticks 2.3 billion times per second). This particular computer uses MASM-like instructions with the following timings: ADD reg, mem ADD reg, immed LOOP _Label Name ; 7 clock cycles (i.e., the ADD micro-program has 7 instructions) ; 4 clock cycles ; 6 clock cycles
image text in transcribed

For sorting in the data table, which properties you cannot sort on ? Group of answer choices Values Cell Color Font Color None of the above

Q2 A) Consider a singly linklist of integers with n number of nodes and value of n IS NOT KNOWN TO YOU. Define a function fun_ques3 () that first finds the total number of nodes in list. If the nodes are even, then find the first even number (only) in the list, else find the first odd number (only) in the list. (Marks 12) INSTRUCTIONS : The

Have to use matlab code, thanks *Question. An airplane of mass 80,000kg lands at a speed of 90m/s and applies its thrust reversers at t=0. The force F that is applied to the airplane, as it decelerates, is given by F=5v2570,000 Where v is the airplane's velocity. Using Newton's second law of motion we can show that velocity changes as a function
image text in transcribed

My code isn't working for this problem. Could an expert deveolp the code so I can see what I'm doing wrong? The program we are using is C Programming. Chapter 3, Problem 9PP Bookmark Show all steps Problem An epidemic of a new strain of flu (i.e., one for which a vaccine is not available) begins with a single case on a college campus of 40,000
image text in transcribed

What does the yield return null statement do in a Crometha It signals the end of the iterator It returns a null value to the calling code It skips the current teration and proceeds to the next one On theows a NulReferencexception

Milestone - Coding - Python - Power Coroutine A custom power coroutine calculates powerbase, exponenv as base ttexponent as long as it receives values, To safely close the coroutine from any further requests, implement a context manager that closes it upon exit. Task requirements: Thite a context manuger pow. genrexps here exp is the exponent to
image text in transcribed

The logic circuit shown in the diagram directly implements which of the Boolean expressions given below? ( ( x + y ) z ) ' + x y ' ( x y ' ) ' + z ' ( x + y ' ) ( y z ' ) + z ( x + y ' ) ( x + y ) ' ( x y ' + z ' )
image text in transcribed

Implement a Java GUI application that prompts the user for the list of integers delimited by commas and a number to search using binary search algorithm. The below screen shot is expected The GUI layout includes: A JLabel control to display the message: Specify the list of numbers for binary-searching, delimited by commas. A JTextField control to
image text in transcribed

In this assignment, you are asked to modify the below code from using a number of nested if statements to using if/else statements with compound conditional expression. A compound condition expression can use logical operators || (or) and && (and) between condition statements to enforce multiple criteria for a condition statement to be either TRUE
image text in transcribedimage text in transcribed

sql queries for rhese questions above 10 DELETE Step 4 Command A- How many computers have a price more than 1700 CAD? Write a query to show the number of computers with a price more than 2000 CAD. B-Delete all computers with prices greater than 2000 CAD, and show the remained computers in our table. S Step 5- More Select, Create and Insert command
image text in transcribed

can u divide this program in .h and .cpp #include using namespace std; class node { private: int data; node *next; public: node (int); void set(int); int get(); void setNext(node *); node *getNext(); void showData(); }; node::node(int x) { set(x); next = NULL; } void node::set(int x) { data = x; } int node::get() { return data; } void
image text in transcribedimage text in transcribedimage text in transcribed

Which statements about the Transmission Control Protocol ( TCP ) are false? ( Select all that apply )

Question: Give a formal proof for the following argument: Premises: (A V B), (A V C) --> Conclusion: A V (B ^ C) Not sure why the last two steps are incorrect. Please help. Proof 6.20 Tet Cube Dodec SameShape Small Mediumm Large SameSize Blocks PetsSetArith LeftOf RightOf FrontOf BackOf SameCol SameRow Between Adjoins Smaller Larger Likes Happy A
image text in transcribed

4. (10 marks) (1) Analysis the diagram and write down the corresponding logic function A B | (2) A 3-input truth table is shown below. Find the minimal sum-of-products and product-of-sums expression for the output F. B A F 0 0 0 0 0 0 0 1 0 0 0 1 1 1 0 0 0 1 0 1 1 1 1 0 1 1 1 1 1
image text in transcribed

creat a program using C++ that will introduce a problem and a solution to the problem. The problem has to be complex enough so that the solution requires the use of objects (classes) and inheritance. However, the problem has to be simple enough so that it can be accomplished within a short period of time (2 weeks or 6 hours worth of lecuters) the

The C++ prog. Should be done with : 1) software is clearly shown 2) Detailed flowchart 3) coding done with excellent programming skills 4) Excellent discussion Question 2: CURRENCY CONVERTER Write a program that will display the following output. First, the user will select the currency to be converted and enter input MYR value by blank. The value
image text in transcribed

2. Consider the Datalog program P: T(x) + f(x), T(x) = a(x, y) A T(y) Ab(x, z) AT(2). (a) Describe, in your own words, the kind of structures that the query (T,P) recog- nises. [4 marks] (b) Compute the semi-naive evaluation of P for the database D with the following facts: e(1) e(2) e(6) a(3,1) a(4,3) a(5,3) a(7,5) b(3,2) b(5,3) b(7,6) Specify
image text in transcribed

What things does a vulnerability assessment scanner do that the nmap application does not do? In the context of cybersecurity, what do each of the letters of CIA stand for? If you were responsible for the security of a school web site where instructors enter student grades, give an xample of a security issue corresponding to each of the three
image text in transcribed

Php and HTML class and this is not Java or python DQuestion 21 5 pts Design a web form that contains a textarea. The textarea will accept a list of integers and words that are separated by comma "," through the textarea, when user hits the submit button, show the results: 1. The count of the integers and the count of words 2. The sum of the
image text in transcribed

Develop a python program that calculates the total cost of renting videos. New videos cost $ 3 to rent, while oldies cost $ 2 to rent. Your program will ask user to enter the number of new videos that they rented, and also the number of oldies that they rented. Then, your program should print the total cost of renting videos.
image text in transcribed

Design a program to calculate the current value of a blackjack hand. The program should read numbers from the user representing each card being added to the hand. Use A for Ace, 2 for Two, 10 for 10, J for Jack, Q for Queen, K for King. After you read a card, display the best total for the hand. Stop reading cards if the user enters S or the value

temperature of a process within the range of 50C to 200C. An 8-bit ADC with a range from 5V to 5V is used to sample the sensor's output. 1. Compute the ADC's resolution in C and V. 2. Assume now that the sensor is interfaced with the ADC through a proper signal-conditioning circuit whose input-output relationship is linear. Find the equation
image text in transcribed

QUESTIONS: 1. Reduce the following expression to its most simplified form. WAB + CD ACD ing expression. 2.Us 2. Using DeMorgan's Theorem and Boolean algebra, reduce the following expresion X = (C + D)ACD(AC + D)
image text in transcribed

Am having issues finding the formula to used sine I have A STUDENTS AND B STUDENTS with just this amount of information sine the data is 700 students can some one help me understand how to find the correct way. I did the fist part sine is finding the A and B students but when I break it apart to find the sample mean excel show that am making an
image text in transcribedimage text in transcribed

Determine the asymptotic complexity of the function defined by the recurrence relation. Justify your solution using substitution/expansion. You may not use the Master Theorem as justification of your answer. Simplify and express your answer as theta(n^k) or theta(n^k log_2 n) whenever possible. If the algorithm is exponential just give exponential
image text in transcribed

twos complement representation of an 8 - bit binary number. ) Functions having array parameters The following declares a function that has a parameter a that is an array of int : void print ( i n t a [ ] ) { } In C , an array parameter always decays to a pointer; in other words, the function above is equivalent to: void print ( i n t * a ) { } and
image text in transcribed

Showing 1200 - 1300 of 1502
  • 13 / 16