S
  1. study help
  2. subject categories
  3. computer science
  4. databases
  5. october 2019
  6. 06

Databases Questions and Answers October 06, 2019

Expert-verified solutions to help you succeed

IT MUST BE IN C++. THANKS :)))) Write a function quadEquation () which takes five arguments, each of type double. The first three parameters a, b, and c, represents the coefficients in the equation ax^2 + bx + c = 0. The last two parameters, r1 and r2, are passed by reference. They are the roots (solutions) to the quadratic equation. Recall that
image text in transcribed

def merge _ list ( list 1 , list 2 , index ) : " " " merge two lists into one list, based on the index received from list 1 as an argument. Args: list 1 ( list ) : A list of items. list 2 ( int ) : A 2 nd list of elements Index ( list ) : The index to merge the list into. Returns: tuple: A tuple of two elements containing both sublists. " " "

overlappingIntervals overlappingIntervals is an adaptation of Exercise 6.1.8 on page 207. overlappingIntervals is a function that should take two (2) vectors of n integer values each as input and return the maximum number of open intervals that overlap at a single point. The first vector defines the starting point of each interval and the second
image text in transcribed

Which of the following algorithms has a time complexity of O ( N * Log ( N ) ) in the worst case scenario?

tion 1 er saved s out of How many results does Goal Seek return? Select one: O a One O b. Two Q c. Five O d. Unlimited lag tion
image text in transcribedimage text in transcribedimage text in transcribed

Find the running time equation, and determine its complexity (in terms of O) of the function p7 below. In [5] # # Input: a list of numbers, L # Output: a list # def p7(L): output = [] for x in L: if x%2==0: output.append(x*2 + 1) return output
image text in transcribed

For this assignment you are to create a Python program with the following capabilities / features . 1 . Starts with a blank list 2 . Uses a while loop 3 . Asks the user to enter a name or type done to stop / exit the while loop 4 . Appends each name to the list 5 . Does not append done to the list 6 . After user exits while loop, asks the user to

Function 2 is called too _ cold. It takes two parameters, temperature and vacation. As a Floridian, if the temperature is below 7 0 degrees it is too cold. Unless you are on vacation and then if is below 5 0 it is too cold. Return True if you are cold, and False if you are not. The temperature parameter will be a float given in Fahrenheit from - 1
image text in transcribed

Please Just Do #5 Consider the following relational schema Product(maker, model, type) PC(model, speed, ram, hd, price) Laptop(model, speed, ram, hd, screen, price) . Printer(model, color, type, price) Write the SQL statement and draw the optimized relational algebra query execution tree for each of the following queries (10 points/SQL 10
image text in transcribed

From your everyday life, select an interface that either (a) leverages the principle of tolerance in its approach to errors, or (b) is intolerant of errors the user commits. Describe the interface, and describe how it responds to user errors, whether by tolerating them or penalizing them. 200 words max Then, describe how the interface might be

python You have to implement and test and upload your codes in a zipped folder by the deadline Use error handling for all questions (The user may insert irrelevant data) 1) (4 points) Write a simple script to ask the user for a Fahrenheit number, then convert it to Kelvin. The formula for kelvin is K= (F + 459.67)* 5/9. 2) (9 points) Write code to
image text in transcribed

Which option describes a select operation? Choice 1 of 3 :Creating a new column in a data frame based on information from other columns. Choice 2 of 3 :Subsetting the columns of a data frame based on their names. Choice 3 of 3 :Subsetting the rows of a data frame based on their values of particular variables.

The following algorithm takes as input a sorted array of integers A. left and right represent the left and right indicies of the array that is being searched. The parameter x represents an integer. The algorithm Search searches whether or not x is in the array A. If x is in the array, it returns the index of x. If x is not in the array, it returns

Text files are what type of file? Sequential Random access Binary Consecutive What do the following statements accomplish? ifstream theFile; theFile open(myFile.txt, ios::in); Opens myFile in read mode Opens myFile in append mode Creates an empty file named myFile Opens a file in input mode to write to When a file is opened in the append mode, the
image text in transcribed

Write a program which: Asks the user to enter any sequence of characters The program should display all the lower-case vowels that are present and the number of times each vowel occurs The program should display all the upper-case vowels that are present and the number of times each vowel occurs The program should display the upper-case vowel

Using prompts (or input boxes and a button), prompt the user for a string. When the user clicks the button, store the string as an array. Using the character for a search key, parse the array to find how many times the key occurs. Display the results. Now remove all instances of the character from the array and display the results as a string.
image text in transcribed

Consider a hash table of size 7 with hash function h(k) = A: mod 7. Draw the hash table after inserting in it. in the given order, the following values into the table: 14, 28, 2, 26, and 70: when linear probing is used to resolve collisions when double hashing with secondary hash function h'(k) = 5 - (k mod 5) is used to resolve collisions.
image text in transcribed

Write python code for this 1. Plot a graph which compares the simple interest and the compound interest of the principal amount of 5000 for 10 years at the interest rate of 15%. Please create two line charts in a single plot with appropriate labels and different colors/styles 2. For the two matrices below, please write a Python program using numpy

Inventory Management System Note: This Program is written in C# in Visual Basic. ------------------------------------------------- Objective: Work with multiple objects and reading data files. ------------------------------------------------- Description: A wholesale distributor has six warehouses (Atlanta, Baltimore, Chicago, Denver, Ely and

Experiencing MIS (6th Edition) Chapter AE, Problem 26Q 1 Bookmark) Show all ON Problem Suppose you work for a company that installs computer networks. Assume that you have been given the task of creating spreadsheets to generate cost estimates, not just for one customer, but for many different clients. a. Create a spreadsheet to estimate hardware
image text in transcribed

I need help writing this method in Java Write a method that reads a text file and, for each line, prints out the number of words in the line. Try it on the file story.txt. This is the story.txt file Flowers for Pachyderm, by Mark Strand As Franz Kafka awoke one morning from uneasy dreams, he found himself transformed into a raging bull elephant.

I can't seem to get the php program to write the results to the fshp and fbo files under the function write files section at the bottom of the code to complete writing to the files. I am not allowed to use global.

5) In Arup's Game of Dice 3, you roll a fair pair of six-sided dice and record the total. If this total is 3, 5 or 12, you win. If it's a 2 or 11, you lose. In all other cases, you roll the pair of dice again. If the sum of this second ro equals or exceeds the sum of your first roll, you win! Otherwise you lose. (For example, if you roll a 6
image text in transcribed

1. m4_1e - a multiplexer with inputs in[3:0], sel[1:0], e and output o. The output o is 0 when e=0 and when e=1 it is in[N] where N is the number corresponding to the binary value of sel[1:0]. 2. m8_1e - a multiplexer with inputs in[7:0], sel[2:0], e and output o. The output o is 0 when e=0 and when e=1 it is in[N] where N is the number

Write an Android phone program such that three rows of widgets will be displayed on the AVD. The first row has two instances of Button with texts Union and Intersection, respectively. The second row has two instances of Button with texts Degree and Tree, respectively. The third row has an instance of TextView with text Definition appears here.

include wave simulation and test bench if possible The binary combinational multiplier diagram: X2 X Xo YO X Y2 Y X Yo Xo Yo X, Yo Xo Y, X Y, X, Y2 X, Y, XoY2 X, Y, P PA . P2 P.; P. Figure 1.3 by 3 binary combinational multiplication diagram Step 3. Final Combinational Multiplier Design X X Xo Yo X X Xo Y cout HA sum HA FA HA (1). HA diagram Xo
image text in transcribedimage text in transcribed

Names are cell references. A . absolute C . relative B . mixed D . formatted
image text in transcribed

(b) Choose Windows Forms App (Net Framework) template in Visual Studio 2017 Figure. Creating a Windows Forms App project in (a) VS 2019 and (b) VS 201 Then, you can use the Toolbox controls to create the GUI design, as shown in Figure 2 Page 3 of 10 A T Figure 2. Design View in Visual Studio 2019 The application GUI must contain at least the
image text in transcribed

MUST RUN IN NETBEANS! Create a program in C++ in netbeans that simulates a simple contact manager application given the following requirements: 1. The program is to store individual names and associated telephone numbers in parallel arrays. 2. The program should input from the user 10 peoples names and their telephone numbers and add the data to

Use Java, write in first-year beginner level. Please do 2 of them and I will give a thumb up otherwise would be a thumb down. Use a line comment at the top to write the problem description. Use meaningful variable names. Problem 1: isInValidNumber Method. The static method isInValidNumber should accept a double number as its argument and return

One intent of the Penetration Test is to simulate what an actual attacker might do . True False
image text in transcribed

21. Encode the following sentences in ASCII using one byte per character. a. Is 1 byte = 8 bits? b. Yes, a byte contains 8 bits! 22. Combine the two sentences of the previous problem and express it in hexadecimal notation
image text in transcribed

Please use a C++ program Task 1: C:WINDOWSlsystem32lcmd.exe ctions on ASK 1: Declare a double-typed variable called money are to deposit this money in a bank which gives you interest of 3% per annum, but interest is given out and added to the money after every mont 3%/12 = 0.25%. tarting amount: RM4880 Month 1 RM4812 Month 2: RM4824.03 Month 3:
image text in transcribed

An array A contains n-1 integers from 1 to n in increasing order, t.e., one integer in this range is missing Write pseudocode that uses a divide-and-conquer approach taking two parameters as input an integer array A, and the range, n, and returns the missing integer Your algorithm must be recursive Hint Start by comparing the middle element Alm]
image text in transcribedimage text in transcribed

//I need to get this function to work but cannot due to first if statement of function int [] sort, help appreciated: public class RecursiveSort { private static Scanner scanner; public static int minIndex(int [] arr, int startIndex, int endIndex) { int sml= Integer.MAX_VALUE; int minIndex= 0; for (int i= startIndex; i < endIndex; i++) { if (sml>

Consider navigating the maze shown below. The maze is represented as a graph with edge costs as shown on the edges. The edge cost is 1 for all edges where the cost is not shown. Let S be the initial state and G is the goal state. The heuristic cost of every node to reach G is : h h(n) A 5.1 B 4.1 C 3.9 D 4 E 2.2 F 3.8 G 0 H 3.7 J 7 K 6 L 4 M 0.5 N
image text in transcribed

JAVA Given the following definition of the classes A, B and C class A { private int a; public A() {a = 1;} public A(int a) { this.a = a;} public int f( int x) {return a*x;} } class B extends A{ private int b; public B(){ b = 2; super(2);} public B(int b) {this.b = b; super(b);} public int f( int x) {return a*b*x;} } class C extends B{ private int

0 In Lecture 3 slide 8 find... Col (101,110 > 100% and 101>) Controlled NOT Gate Cij: if the state of the ith Chit is (o>, leave the target Cbit unchanged. Otherwise apply NOT. C10 x>\y>=|x>lyx> and C.1 x>ly>=|x Oy>ly> Where is XOR or modulo-2 sum: |0> 00>=10>, lo> 1>=[1> and [1> 0|0>=[1> and 11> [1>=10> Thus: C10|0>]1>=|0>]1 00>=|0>]1>, and Co
image text in transcribed

Answer the following questions: 1. What makes you unique in completing your job? 2. What are your passions? 3. What are you best at? 4. What makes you You? What you done personally to build your personality? 5. What have you accomplished? Write personal brand biography in the third person in three models - Shortest; - Shorter; - Short. using as a
image text in transcribedimage text in transcribed

Chapter 8 Project Project Name: Chpt8_Project Class Name: Chpt8_Project Write a program that determines how many credits 10 students need to graduate. Step 1. Create an algorithm (either flowchart or pseudocode) that you will use to write the program. Place the algorithm in a Word document. Step 2. Code the program in Eclipse and ensure the
image text in transcribedimage text in transcribed

context free language of L = { anbmck | k = n + m , n , m , k > = 0 }

Application domain. Consider a simple banking application in which customers perform transactions on some of their accounts. For this purpose we have the database schema that consists of the following three relation schemata: CUSTOMER Cid, name, phone ACCOUNT num, type, desc TRANSACTION num, type, cid, time, amount Domains of attributes have been
image text in transcribedimage text in transcribedimage text in transcribed

******import sys and sys argv NO INPUT FUNCTION***** 3. Filename: assign3-11.py Write a program that takes three numbers and determine the minimum and maximum among them. You are not allowed to use min and max functions. Input: a) python C:\Users eda\DataProgramming\M3\assign3-11.py -2 100 50 b) python C:\Users eda\DataProgramming\M3\assign3-11.py
image text in transcribed

Need help with this question in Java. I know you wont have the file, but I would appreciate instructions or sample code to assist me. Thank you Write a program that prompts the user to enter a file name (use a JFileChooser). The program outputs to the screen the number of lines, words and characters in the file (that you collected with the
image text in transcribed

Use Basic/Beginner C++ skills, code in Visual Studio 2017 Also use cin/cout,etc When a ball is thrown vertically upward from a reference location, it travels to a maximum height and then changes direction and experiences a fall. Ignoring the air resistance and a number of other tiny influences, the location of the ball (H) and its velocity (V) at
image text in transcribed

I need help converting the number input from int to double, and add a decimal button to my code //GUI Calculator Program import javax.swing.*; import java.awt.*; import java.awt.event.*; import java.io.*; public class Calculator extends JFrame implements ActionListener { private JTextField displayText = new JTextField(30); private JButton[] button

This is a cryptography question from the book Introduction to Modern Cryptography by Katz and Lindell 2nd Edition. If needed, please refer to the textbook Exercise 8.16 to answer the question. Find all of the points on the elliptic curve E y a3 2a 1 over 11 How many points are on this curve (Don't forget about the identity!)
image text in transcribed

Question 7 0 . 6 pts Which of the following is one of the management and people changes posinglo major management challenge in the business use of information systems? Cloud computing The Internet of Things The mobile platform Big Data Online collaboration and social networking
image text in transcribed

okay this is another exercice i hope u can read it better Aufgabe 2 Modularisierung (4 Punkte) Abgabe: main.c, bubblesort.c, bubblesort.h Auf OLAT finden Sie ein Programm refactor.c, das eine eingegebene Folge von Integern aufsteigend sortiert ausgibt. Das Programm soll auf zwei Module main.c und bubblesort.c aufgeteilt werden. Dabei soll main.c
image text in transcribedimage text in transcribed

Consider the following C program: Write the output. 1 #include ?stdio.h? 3 void calculate(int * p, int n, int * x, int * y) i 4 int * a - p; int z- *a; int i; if(n?1) return; if (a[i] z) for (i -1; i
image text in transcribed

(30) 2. Design an even-parity checker for values 0-15. An even-parity checker takes four bit binary values from 0-15 and generates a 'l' at the output when there are even number of ones in the input binary representation, and generates a "O at the output if there are odd number of ones in the input binary representation. Remember: Zero is
image text in transcribed

Consider the following NFA: What states could we end up in if we start in state q0 and read in the string bb? Write out the formal 5-tuple of this NFA (for the S transition function, use a table like the one on page 54 of the textbook) What language does this NFA recognize
image text in transcribed

in C++ Write a program in any programming language to implement the following scheduling algorithms: 1. Round Robin scheduling algorithm with variable quantum (q). The user should enter the quantum (q), a number of processes, their arrival times and their burst times in seconds. 2. Pre-emptive Shortest Job First. The user should enter a number of
image text in transcribed

Please help code this in python. This is how the expected output is supposed to look like : [['Choc', 8], ['Vani', 10], ['Stra', 11]] Please help me fill in the missing code Write a procedure that receives an inventory and modifies it in such a way that duplicate products are merged. All the quantities for the same product has to be added and the
image text in transcribedimage text in transcribed

I'm not sure how to do the calculation. I need amount = principal * (1+rate/t)^t please help! Assuming there are no deposits other than the original investment, the balance in a savings account after one year may be calculated as: T amount = principal (1 + rate)" Where principal = original balance in the account rate = interest rate T= number of
image text in transcribedimage text in transcribedimage text in transcribed

NTWK-229-99V INFORMATION SECURITY FUND 1) Use the Internet to select some USB flash drives that support hardware encryption. Compare their features. Be sure to include any unique features that the drives may have along with their costs. Which would you recommend? Why? Discuss your research 2) what is the best access control model? Why? 3) what is
image text in transcribed

Needed in python. The purpose of this assignment is to understand which cryptographic functions can be used to accomplish a certain security objective. In this exercise Alice will send a short message to Bob. The message would be sent to Bob along with an encrypted message digest. Bob is required to authenticate and verify the integrity of the

The Postorder Traversal of the following tree is: ered 2.00 Fion Select one: O A.( Y Q R X Z T) OB.( Y Q R XTZ) OC. Y QX RZ T) D. ( Y QTX ZR) 22
image text in transcribed

(10 pts) Using Figure 7.1 of CLRS (Page 41, lecture slides for Chapter 7) as a model, illustrate the operation of the Partition procedure as given in lecture (Page 40, lecture slides for Chapter 7) on the array . Assume that the last element of the array is selected as the pivot element. Indicate values of i and j after each step. i pj (an) p.i j
image text in transcribed

is the magnitude of Google's revenue. Select one: a . licensing b . user fees c . advertising d . Android e . registration charges
image text in transcribed

java If integer dimensionsNumber is 3 , output "Three - dimensional space". Otherwise, output "Not a three - dimensional space". End with a newline. Click here for examples Ex 1 : If the input is 3 , then the output is: Three - dimensional space Ex 2 : If the input is 1 4 , then the output is: Not a three - dimensional space

Please answer these 5 questions based on this diagram Database named OT which is based on a global fictitious company that sells computer hardware including storage, motherboard, RAM, video card, and CPU. The company maintains the product information such as name, description standard cost, list price, and product line. It also tracks the
image text in transcribedimage text in transcribed

Note: in all of the below capital letters are non-terminals, non-grammar symbols are terminals. 0. Given the following grammar, G: SAS#S|A@A A+CCA Ca|bc 1. Rewrite grammar G so that: - no string in it is ambiguous - # has higher precedence than @ - # and @ are both left-associative (i.e. a #b #c should mean (a #b) #c)
image text in transcribedimage text in transcribed

This is runner code: import java.util.Scanner; import java.util.ArrayList; public class runner_U7_L4_Activity_Two{ public static void main(String[] args){ Scanner scan = new Scanner(System.in); ArrayList words = new ArrayList (); System.out.println("Please enter words, enter STOP to stop the loop."); String input = scan.nextLine();
image text in transcribed

Time left 1:12:35 Suppose that each line in a text file "Tawjihi.txt", has the student ID, first name, middle name, last name and Tawjihi grade separated by "-". In addition, suppose that a UDP server "tawjihi.aauj.edu listens on port 9000 and that it expects to receive from clients lines that contains student ID and first name separated by a
image text in transcribed

Please yse Python code and give the python codes and also explain the ploys as per asked by the question
image text in transcribed

Concerning cursors, an explicit cursor must be created when: Question 9 options: You are executing a SELECT statement that returns more than one row You are executing a INSERT statement that affects more than one row You are executing a SELECT statement that returns only one row You must always use explicit cursors-implicit cursors have been
image text in transcribed

Completed part 1 JUST NEED PART 2 PLEASE! import java.util.Scanner; import java.text.DecimalFormat; import java.io.BufferedWriter; import java.io.File; import java.io.FileWriter; import java.io.FileOutputStream; import java.io.IOException; import java.io.OutputStreamWriter; import java.io.Writer; public class TestCircle { public class Circle {
image text in transcribedimage text in transcribedimage text in transcribed

CS-106 Lab 1 British Currency The web page below describes the British currency system: https://en.wikipedia.org/wiki/List_of_British_banknotes_and_coins One pound 1 Introduced in 1983 to replace the one pound note. Fifty pence 50p Introduced in 1969, just prior to decimalisation, to replace the ten shilling note ("ten bob note"). It was initially
image text in transcribed

JAVA Write a BankAccount class and a custom Exception class to handle deposits and withdraws operations. The BankAccount class should have three main methods, withdraw, deposit and Monthly_Dividend. While the custom Exception class "NotEnoughBalance "should contain an amount and a message to tell what the reason was for the Exception. The
image text in transcribedimage text in transcribedimage text in transcribed

For a Python class, what iof the name of the special method that is called when you create an instance of the class? Constructor. The constructor's name is the same as the name of the class. none of the above
image text in transcribed

In the context of a Data Warehouse, which of the following is a type of schema? A . Star B . Snowilakes C . Structured D . Both A and B
image text in transcribed

6 Decipher ( 6 pts ) Using the information from the previous problem, solve for x in terms of y . Use this to help decrypt the message at the beginning of question 5 .

Question 6 The following sequence is an example of: QSEO ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT FASTA format FASTQ format SAM format PDB format
image text in transcribed

During an Activity lifetime, what is the first method callback of the Activity class invoked by the system? Question 8 options: a ) onCreate b ) onPause c ) onStart d ) onResume

Question No 3 Timer: 01:35 Mark 2 Ir the sitze of the plaintext data is 1024 bits, the mber of the card performed by the implementation of the AES algorith discessed our material) is: at 16 B. 32 B D. 135 E352
image text in transcribed

( Hint: Division is essentially successive subtaction ) 3 Assembly Programs: ( a ) A user wants to store the first ten natural numbers ( in fexith t . . assembly program to achieve the goals
image text in transcribed

, answer the following questions: Figure 1 : ( a ) What is the start state? ( b ) What is the set of accept states? ( c ) What sequence of states does the machine go through on input aabb ? ( d ) Does the machine accept the string aabb ? ( c ) Does the machine accept the string l o n ? ( f ) Further, give the formal description of the DFA.
image text in transcribed

QUESTION 1 Which of the following is NOT true of anonymous inner classes? They are declared with the anonymous keyword. They can access their top-level class's members. OThey typically appear inside a method declaration They are declared without a name QUESTION 2 Which of the following statements is not true about the JFrame? JFrame is a subclass
image text in transcribedimage text in transcribedimage text in transcribed

The gradations of light and dark values in two - dimensional images is called? a . chiaroscuro b . intensity c . tint d . value
image text in transcribed

A map is represented as a matrix of integer values. The starting cell of the map is always at the top-left corner (element 10.01). while the ending cell is always at the bottom-right corner (element fr-1, C-1), where r and care the numbers of rows and cotumns of the matrix, respectively). It is possible to walk die., visit) the map by moving from
image text in transcribed

PROGRAM SHOULD BE IN C++ .The purpose of this program is to ask the user to input a string into a C-string (i.e. a character array) using the cin.getline function (see section 10.3 of Chapter 10, this will allow you to also include spaces in the input stream). Then, a function reverseStr will accept the character array as an argument, and return

using c program Write/Implement a function definition for a function my_strncat () with the following header: char *my_strncat (char *destination, const char *source, int n) This function appends no more than n characters from the string pointed to by source to the end of the string pointed to by destination. The null character is appended to the
image text in transcribed

Can anyone please help me with Matlab. The van der Waals equation of state can be used to calculate Volume of a real gas at moderate Pressure. van der Waals equation and all related data are given below: P = RT/V - b - a/V^2 Polynomial form of van der Waals equation: f(V) = PV^3 - (bP + RT) V^2 + aV - ab R = 0.0821 litre-atm/degree K-mol; a =
image text in transcribed

Choose the correct Option: Which one of the following refers to term 'separation' in security of Operating systems? To have separate login for different users To have separate Hard disk drive / partition for di It means keeping one user's objects separate fr None of the mentioned
image text in transcribed

3. Using Amdahl's Law, calculate the speedup gain of an application that has a 70 percent parallel component for: a. Two processing cores b. Four processing cores c. Ten processing cores
image text in transcribed

write it in C programming Write a primary functions of stack: push() and pop() push0: create a new node and places it on top of stack pop0: remove a node from the top of stack, free the memory that was allocated to the popped node and return the popped value There is a sample code in next slide and blackboard Enter choice: 1 to push a value on the
image text in transcribed

In your first programming project you created a java file called Quadratic.java, which took the Coefficients of a quadratic equation and gave the two solutions for the variable X. At the time we assumed the user would give us three values that would successfully work. However if the user gave us a zero for the A term or a set of values that caused

Part 3 Turing Machines Design a Turing machine on the input alphabet {x, y, z} that removes all z characters from the input such there are no gaps. If the input string is xzzyxzy, the output should be xyxy. Hint: The final string does not need to reside on the same part of the tape where it started
image text in transcribed

Plot the three functions 21,2,3(t) = e a'2 cos(4), corresponding to a = 1, 1.5, 2, versus 031510 in the same graph. Adjust the limits of the vertical axis to -0.8 and 0.8. Add grid and label. Use ezplot() to plot your graphs
image text in transcribed

Use Python to implement a function called deep_copy which satisfies given conditions. Please do not import modules. # Mutation Mystery def deep_copy(1st): n"Returns a new list that is a deep copy of Ist. >>> y = deep-copy(x) S> y SSX >z deep_copy(x) S>Z SS> X #x should not change
image text in transcribed

*********You cannot use loops ************** **************only if else and switch************* ********* for exponents please use math pow***************** comments are not necessary Write an algorithm and then the code for a java program that is a simple calculator. The algorithm or program plan must be in a Word document uploaded with this
image text in transcribedimage text in transcribed

The reciprocal of inputConduct is 1 / inputConduct. The following program intends to read a floating - point value from input, compute the reciprocal of the value, and output the reciprocal, but the code contains three errors. Find and fix all three errors. Ex: If the input is 0 . 9 0 0 , then the output is:

please show hand drawn work not coding solutions 1. Design a comparator circuit capable of taking a 4-bit input, from 3 to 12 (other numbers are the "don't care" cases), and the ability to compare with number 9 . If the input is greater than 9, output 1; otherwise output 0 . Draw the circuit. 2. Study section 6.5 of Lee's text and assume Fig. 6-21
image text in transcribed

4. (1+1+3 points) An economy consists of two sectors: Manufacturing and Service. In order to produce 1 unit of output, the Manufacturing sector uses 0.7 units from Manufacturing and 0.1 units from Service. In order to produce 1 unit of output, the Service sector uses 0.1 units from Manufac- turing and 0.3 units from Service. (a) Write down the
image text in transcribed

# simple demo showing how to use pyowm ############ # This is the part one of your Python weather report project ############ import pyowm # You have to register on the OWM website to get an API key myAPIKey = 'your API key' owm = pyowm.OWM(myAPIKey) # You MUST provide a valid API key # You have a pro subscription? Use: # owm =

Question 1: (2 MARK) Name entities, attributes, activities, events, and state variables for the following systems and Discuss whether the simulation should be static or dynamic, deterministic, or stochastic, continuous, or discrete. a) Restaurant b) A taxicab company with 15 taxis Entities Entities Attributes Attributes Activities Activities
image text in transcribed

Match the algorithms on the left with their correct time complexity from the right. Note that you dont have to use all of the time complexities on the right. 1. Inserting one element in a Heap of size n a) (1) 2. Heapsort for n elements b) (logn) 3. Heapify an array of size n c) (n) 4. Preorder Traversal of a balanced tree with n nodes d) (n logn)

MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB Hi sir please help me i have short time 1)for this image; write a MATLAB program that finds the areas and centers of objects (Write your MATLAB codes in a description) MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB MATLAB
image text in transcribed

USNG PYTHON 3 PLEASE. 4) According to the Turkish Seismic Design Code (TSDC 2019), the local site classes are defined as ZA, ZB, ZC, ZD, ZE and ZF, depending on the mean shear wave velocity (V3) 30 of the uppermost 30 m of the soil/rock profile. Table 1 below shows the local site classes and soil types for the given (V.) 30 values. Table 1. Local
image text in transcribed

Showing 1100 - 1200 of 1501
  • 12 / 16