Question: Write a program for the following scenario with sample output(IN JAVA) Scenario: (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and

Write a program for the following scenario with sample output(IN JAVA)

Scenario: (Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a sub string of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, displays no gene. Here are the sample runs:

Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT

O/P: TTT

GGGCGT

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

In Python Programming: (Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends...

In Python Programming: 812 (Bioinformatics: find genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and...

Summary Using your knowledge of loops and String variables, you will create a program that calculate and create a report of some basic statistics and genomic quantities on DNA base-pair sequences....

Using your knowledge of loops and String variables, you will create a program that calculates and creates a report of some basic statistics and genomic quantities on DNA base-pair sequences. The...

Need help with this code in C++ using only string functions and the simplest as possible As well as using namespace std; Biologists use a sequence of letters A, C, T, and G to model a genome. A gene...

HI I need the problem to be a solution of the second proble. but as you will see they are related. I will provide my failed solution and frome there you can understand where I fail. the following is...

Can someone write a python program? Explain to me how the program work e appears 1 time in computer Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model...

PYTHON Program Set 4(10 points extra credit) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a...

Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the...

A wheel rotates at 36.0 rad/s. (a) How long (in s) does it take to complete one revolution? (b) How many revolutions does it complete in 8.00 s?

Let us solve a two-period consumption investment decision similar to the one presented in the text. Assume that you have income equal to $20 in each of two periods. Furthermore, you have the ability...

You are a wise professional who starts saving from the first year of employment. You save the following amounts at the end of each year: Year 1 2 3 4 5 6 Savings $ 5 0 0 0 0 6 0 0 0 0 7 0 0 0 0 8 0 0...

Compared with half a century ago, adoption has become _ _ _ _ _ _ _ _ _ common, but it is more open and acceptabl e , so we probably discuss it _ _ _ _ _ _ _ . fill in the blanks more or much less or...

12-2 How do information systems support the activities of managers and management decision making?

12-3 How do business intelligence and business analytics support decision making?

12-1 What are the different types of decisions, and how does the decisionmaking process work?