A transcript was identified in the nucleus that is similar to this transcript. How is it likely

Question:

A transcript was identified in the nucleus that is similar to this transcript. How is it likely different from the mRNA transcript?

(A) The nuclear transcript likely contained introns.
(B) The nuclear transcript likely contained exons.
(C) The nuclear transcript likely contained a poly-A tail.
(D) The nuclear transcript likely contained a 3' GTP-Cap.

A certain gene has been identified on chromosome 2 in a species of butterfly. The mRNA transcript has been found to be 1578 base pairs in length. A portion of the transcript is shown below. The area shown in grey is part of a known ribosome binding site. 5' UUACGUGCAUGCGUAGCUAGCUAGCUAUGCUAUCGCUUUAAGAGCAAAAAA 3' 15 30 45