Where on the strand shown in Figure 1 is a transcription factor likely to bind? (A) Bases

Question:

Where on the strand shown in Figure 1 is a transcription factor likely to bind?
(A) Bases 0 to 15
(B) Bases 20 to 25
(C) Bases –20 to –15
(D) None of the above

A certain gene has been identified on chromosome 2 in a species of butterfly. The mRNA transcript has been found to be 1578 base pairs in length. A portion of the transcript is shown below. The area shown in grey is part of a known ribosome binding site. 5' UUACGUGCAUGCGUAGCUAGCUAGCUAUGCUAUCGCUUUAAGAGCAAAAAA 3' 15 30 45