If bases 0-15 were deleted, what would be the likely consequence? (A) No transcription would be allowed

Question:

If bases 0-15 were deleted, what would be the likely consequence?

(A) No transcription would be allowed to occur.
(B) No translation would be allowed to occur.
(C) Neither transcription nor translation would occur.
(D) No consequence would occur as these bases are non-coding.

A certain gene has been identified on chromosome 2 in a species of butterfly. The mRNA transcript has been found to be 1578 base pairs in length. A portion of the transcript is shown below. The area shown in grey is part of a known ribosome binding site. 5' UUACGUGCAUGCGUAGCUAGCUAGCUAUGCUAUCGCUUUAAGAGCAAAAAA 3' 15 30 45