Question: The work done by a conservative force is indicated in FIGURE 8-23 for a variety of different paths connecting the points A and B. What

The work done by a conservative force is indicated in FIGURE 8-23 for a variety of different paths connecting the points A and B. What is the work done by this force
(a) On path 1
(b) On path 2?

W = 18 J %3D A W = 15J Path 1 W = -5J Path 2 W = -6J

Step by Step Solution

★★★★★

3.46 Rating (178 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

The work done by a conservative force is independent of the path taken From the middle pa... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

1307-P-M-K(3027).docx

120 KBs Word File

Students Have Also Explored These Related Mechanics Questions!

(Multiple choice) (1) A woman runs up a flight of stairs. The gain in her gravitational potential energy is U. If she runs up the same stairs with twice the speed, what will be her gain in potential...

(a) Calculate the work done from D to O by the force P of Problem 13.82 by integrating along the diagonal of the cube. (b) Using the result obtained and the answer to part b of Problem 13.82, verify...

A bicyclist rides 5.0 km due east, while the resistive force from the air has a magnitude of 3.0 N and points due west. The rider then turns around and rides 5.0 km due west, back to her starting...

14. [-110 Points] I DETAILS I SE RPSE1O 7.6.09.024. MY NOTES ASK YOUR TEACHER PRACTICE ANOTHER A 44D-N child is in a swing that is attached to a pair of ropes 1.90 m long. Find the gravitational...

Please carefully take your time to do these Work and Energy questions from PCS211! 17. [-I4 Points] SERPSE10 7.7.P.O31.MI. MY NOTES ASK YOUR TEACHER PRACTICE ANOTHER A 5.007kg particle moves from the...

put answer on image please An 8.00-kg particle moves from the origin to position @, having coordinates x = 5.00 m and y = 5.00 m as shown in the figure. One force on the particle is the gravitational...

solve for the parts not answered please make answer easy to read An 8.00-kg particle moves from the origin to position @, having coordinates x = 5.00 m and y = 5.00 m as shown in the figure. One...

Section 6.5 Reading Assignment: Work and Fluid Forces Answer Only Exercise 1, 2, and 3 by using a screenshot provided Calculus Pearson textbook. Make sure you read these three questions very...

Find the Jordan form from the given data. (a) The matrix T is 5 5 with the single eigenvalue 3. The nullities of the powers are: T - 3I has nullity two, (T - 3I)2 has nullity three, (T - 3I)3 has...

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Who was the originator of the concept of production management? a. F.W. Taylor b. Eli Whitney c. Henry L. Gantt d. Adam Smith

22. Prove that the event B is impossible if and only if for every event A, A = (B Ac) (Bc A).

Assume a planet is a uniform sphere of radius R that (somehow) has a narrow radial tunnel through its center (Figure). Also assume we can position an apple anywhere along the tunnel or outside the...

A solid uniform sphere has a mass of 1.0 x 104 kg and a radius of 1.0 m. What is the magnitude of the gravitational force due to the sphere on a particle of mass m located at a distance of? (a) 1.5 m...

Consider a pulsar, a collapsed star of extremely high density, with a mass M equal to that of the Sun (1.98 x l030 kg), a radius R of only 12 km, and a rotational period T of 0.041s. By what...

3. Given the data Y1 : 10,172 : 9 and Y3 : 9.5, we want to t an ARIMA(0,1,1) model without a constant term. Estimate (9 and JE using the method of least squares

Hindustan Motors has been producing its Ambassador car in India since 1948. As the companys Web site explains, the Ambassadors dependability, spaciousness and comfort factor have made it the most...

a) Results from a Gallup Youth Survey reveal that teens most often mention "violence, fighting, and school safety" when asked to name the biggest problem their schools must deal with. The report of...