S
  1. study help
  2. subject categories
  3. computer science
  4. databases
  5. october 2020
  6. 08

Databases Questions and Answers October 08, 2020

Expert-verified solutions to help you succeed

It is common to need to make choices between different alternatives when solving problems. Alternatives can take different forms. For instance, only do action X if condition 1 is true presents an alternative of either doing or not doing action X. A different form of alternative occurs in the case where we need to do action X if condition 2 is

stion 12 yet vered struct act personal InfoType ked out of Consider the following statements struct nameType struct dateType string first int month: string last; int day: int year: }; ); personal InfoType person: personal InfoType classList(100); nameType student : nameType name; int PID: dateType dob; lag question 1: Which of the following
image text in transcribed

You have watched the NVivo introductory video and reviewed the NVivo website. Now you need to review in more detail a specific aspect or component of NVivo and report on it to the class in this discussion board. You can explore the NVivo website for more detail about a specific ability, or you can watch any one of the NVivo YouTube videos which

write in matlab or the code 2.4. (0.5 points) Calculate the Taylor series approximation of ex. The logic statement requires that the loop continues until absolute value of the relative change in the approximation of ek is less than 10-6. Use x = 0.5. Display the output. 00 x e = n=1 I n! 7 %
image text in transcribed

Prompt for a string containing integers separated by spaces. Load the values into a list. Swap the minimum and maximum elements in the list. Do not use the list or string functions or methods for this assignment (except the .split() method). Do not use the for x in y iterator, use for x in range(n) Enter Values Separated by Spaces: 3 4 5 2 1
image text in transcribed

write a java program Given an array of sorted integers. We need to find the closest value to the given number. Array may contain duplicate values and negative numbers. Example - Input :arr [ ] = { 2 , 5 , 6 , 7 , 8 , 8 , 9 } ; Target number = 4 Output : 5 Target number = 3 Output : 2

In this question, you will practice using binary trees in a real-world application. Huffman encoding is a technique for encoding characters using a variable number of bits for each character. More frequent characters are encoded with fewer bits, resulting in a compression of the number of bits required to encode a complete file (this is one

C++ DNA Analyzer Program Text File TACTTAGTTTTTATACTAGAAGGCTACGATACCCAGGTAAGTTGTGTTAAAGGAGTCGGTAACTAAAACATTCAATGAACAACAGTACCAATAGATTCGA TTTGTGCAAACGTTGGGGGCCCTCTTGTGACCGCATGTACTGAAATGGACCCTACAACGCCTGAACATAGCGCCATTTTATGACATTTTGCCACGGACCT AAATCGGCGAATAACTCCCGTCAGACTCGCACTACCGTTCTCAAAAGCGGTGCCATGTAGCGTGAAAACATATTCTTGAGGCCGAAGCGCCGAGCTTGTC
image text in transcribed

Roma 12 A Aa A E AL . Ar E. 1. | | el . . Heading 2 1 No Spac... Heading 1 Heading 3 Heading 4 1 Normal Title Sutiti funt Paragraph Styles 2. Consider the arrival time and burst time of five jobs specified in the table below. a. Apply the Shortest Remaining Time to Finish (SRTF) operating system algorithm. b. Generate a table to identify the
image text in transcribed

We can use command "openssl s _ client - crlf - connect mail.cock.li: 9 9 3 " to fetch emails from the mail.cock.li server ( an IMAPS server listening at port 9 9 3 ) . However, the email content will be encrypted. 1 . Please do search / research to figure out a command option / parameter / switch for openssl to save the session key in a log file

It is safe to share or pass mutable references. True False

write a HTMl code for the follow luandry App below
image text in transcribed

Choose all the cloud computing services below that allow customers to develop, run, and manage web - based applications without the complexity of building and maintaining the infrastructure typically associated with such applications. Question 6 options: IaaS SaaS PaaS BaaS

Which of the following is true about the Purpose of the Page and the Page Quality ( PQ ) rating?

A distributed system is likely more difficult to protect from spam attacks than a centralized one. Group of answer choices True False

Chapter 11 of the Practical Time Series Forecasting textbook (pages 211-214). "Background: Forcasting transportation demand is important for multiple purposes such as staffing, planning and inventory control. The public transport system in Santiago de Chile has gone through a major effect of reconstruction. In this context, a business intelligence

It is possible for a computer with a single logical address to have more than one NIC each with distinct MAC addresses. True False Switches handle only one packet at a time while hubs can handle multiple incoming and outgoing packets simultaneously. True False Distance vector routing algorithm considers latency in the network before assigning a
image text in transcribed

CAN I GET HELP WITH THESE RELATIONAL ALGEBRA QUERIES PLEASE? YOU CAN ANSWER IN RELATIONAL ALGEBRA OR SQL. EITHER WAY IS FINE. THANKS IN ADVANCE! Building(s) student(s) Brown had classes in the Spring 2010 semester. classroom building string room_number number capacity number department dept_name string building string budget number course
image text in transcribedimage text in transcribedimage text in transcribed

2. Carrano, 4th edition, Chapter 10, Exercise 2 What are the preorder, inorder, and postorder traversals of the following binary trees
image text in transcribed

Use Table 1 in the article to answer the following question The primany position of elay assceiated With the greatest number of mild CTE cases was [ Seteat ] While the primary position of play associated with the greatest number of severe CTE cases was [ Select ]
image text in transcribed

Write a program to implement a Dictionary of integers which consists of following methods using JAVA language: SortedArray(int a) : is a constructor which creates a dictionary of size a. void insert(int x) : Inserts element x at its proper position. o Raise exception Dictionary_Full when dictionary is already full (in case of SortedArray) o If x

Number of needed usable hosts: 29 Network Address: 23.0.0.0 Address class: Default subnet mask: Custom address map: Number of subnet (borrowed) bits: Total number of network bits: Total number of host bits: Custom subnet mask: Total number of subnets: Total number of addresses: Number of usable addresses:

Assume the following: . The memory is byte addressable. . Memory accesses are to 1-byte words (not to 4-byte words). . . Addresses are 10 bits wide. .. The cache is 2-way associative cache (E=2), with a 2-byte block size (B=2) and 8 sets (S=8). The cache contents are as shown below Set #Way #0 Way #1 v=1;Tag=0x30; Data = v=1;Tag=0x2d; Data = 0:
image text in transcribed

Which of these describes an application's ability to increase or decrease its processing capabilities based on demandt? A . Scaling B . Growing C . Sharding D . Robustriess
image text in transcribed

Which of the following is an open source project that allows you to deploy micro - segmentation policy - based services in container environments? A Contiv B OVS C All of these D ODL
image text in transcribed

11. Find EMA(4, 4) for the data set {40, 40, 24, 20} if p=1/4. Discuss the solution! (0.5 point)

Using a Content Management System (CMS) of your choice or using HTML/CSS/JavaScript/PHP, design and implement an E-Commerce web application that sells products (of your choice) and should allow users to browse the products, add products to a shopping cart, and checkout items in the cart. Your application should be visually appealing with good

Data management platforms allow people to utilize which type of data to target a specific audience on ad networks? First Party Second Party Third Party Fourth Party First Party & Third Party are correct and Second Party & Fourth Party are incorrect First Party and Second Party are correct and Third Party & Fourth Party are incorrect First Party,
image text in transcribed

1. Read the following carefully and then see if you can figure out why these are bad engineering requirements a. The system shall validate and accept credit cards and cashiers checks. High Priority b. The system shall process all mouse clicks very fast to endure users do not have to wait c. The user must have Adobe Acrobat installed

In java, please finish this method ? ? * * * * Saves all of pieces of clothing in this wardrobe to the designated file. Each piece of clothing in the Wardrobe is written on its own line, formatted as description, brand, ZastWornDate, timesWorn. The date must be formatted MM / DD / YYYY . For example, lets say a piece of clothing had a description
image text in transcribed

Implement the following 3 CPU scheduling algorithms Simulate and Evaluate each with the set of processes below. FCFS non-preemptive (results provided) SJF non-preemptive MLFQ Multilevel Feedback Queue (preemptive absolute priority in higher queues) Queue 1 uses RR scheduling with Tq = 6 Queue 2 uses RR scheduling with Tq = 11 Queue 3 uses FCFS All

Write a program that calculates the CRC-16 value for a given file and which can also verify the correctness of a given file that already has a CRC-16 value appended to it, as more fully described below. Use the CRC polynomial: x 15 +x 13 + x 6 +x 4 +x 1 +1. Program operation: The program must compile from the command line. The program executable

6. A pair of fair dice is thrown. (a) (6 pts) Given that the sum of two dice is 10 or greater, find the probability 5 appears on the first die (5 pts) Given that the sum of two dice is 10 or greater, find the probability 5 appears on at least one die (b) (5 pts) Given that the two numbers appearing are different, find the probability of the sum is
image text in transcribed

Question 3 3 pts Determine whether the following formulas are tautologies, contingencies, or contradictions in ( non - classical relevance logic ) System RP . notAvv ( B A ) ( n o t A v v n o t B ) not ( A & B ) not ( A & B ) ( n o t A v v n o t B )
image text in transcribed

Please explain what did I do wrong, and how should I fix it; please do not simply leave an answer, thank you so much. ZYDE 1.4.2: Fixing syntax errors. Click run to compile, and note the long error list. Fix only the first error, then recompile. Repeat that process (fix first error, recompile) until the program compiles and runs. Expect to see
image text in transcribed

list all customers who were referred to the bookstore by another customer. List each customer's last name and the number of customer who made the referral. This question is from Oracle 12c's chapter 8 hands on assignment

undefined Create a new project in Code Blocks. Write a C++ program which reads the state Teams.txt you created in Part A using the appropriate data structure to manage the team data. For each Team calculate a raw win+loss score, where wins+loss equals the sum of points won or lost, and a curved rank using their median ability score to curve the
image text in transcribedimage text in transcribedimage text in transcribed

write a python prgram that accept an integer and tell me if it is a pprme number

I need help with 8-10 ioi Cascading Style Sheets | HTML and CSS 8. Create a style for the body element so text on the Web page appears in a font size of 1.2em and in Arial, which is a sans-serif font. Also format the body element to have a background color of #e6e6fa. 9. Add a style to make emphasized text appear in green and bold. 10. Add a style
image text in transcribedimage text in transcribed

Write the complete entity and architecture for implementing the following state machine in VHDL using a 2-process state machine. Make sure to include both the entity and architecture declarations. You are also expected to create your own custom data type for keeping track of your states. reset STOP. PRESJED startstop /start stop START_RELEAJCD
image text in transcribed

12. In this question well consider learning problems where each instance x is some integer in the set X = {1, 2, , 125, 126, 127}, and where each hypothesis h 2 H is an interval of the form a x b, where a and b can be any integers between 1 and 127 (inclusive), so long as a b. A hypothesis a x b labels instance x positive if x falls into the

Let us consider a computer with a L1, L2 and L3 cache memory hierarchy with the following parameters: Processor Clock Frequency = 1 GHz ; Hit Time L1 = 1 clock cycle ; Hit Rate L1 = 95%; Hit Time L2 = 4 clock cycles; Hit Rate L2 = 92% ; Hit Time L3 = 8 clock cycles; Hit Rate L3 = 90% ; Miss Penalty L3 = 15 clock cycles; Given Memory Accesses Per

Consider the following scenario for a video game development company: EA Games is a video game development company. The creation of their video games require ideation, design and development before it is launched to public. This is called Post Production, which is also the most challenging part for EA Games. Due to an inefficient process and lack

What are the three general types / levels of computer programming languages?

For this part, the alphabet is { 0 , 1 , # } . Show that the following language is not context - free: NORUN = { w 1 #w 2 # . . . #wn | w 1 , . . . , wn in { 0 , 1 } and i in { 1 , . . . , n 1 } , wi not equal tow _ i + 1 ^ R } .

which one of these components provides data redundancy for storage

Design and implement a set of classes that define various types of electronics equipment ( computers , cell phones, pagers, digital cameras, clock, etc ) . Include data values that describe various attributes of the electronics, such as weight, cost, power usage, and the names of the manufacturers. Include methods that are named appropriately for
image text in transcribed

Write a function reportDuplicates ( ) that takes a two di - mensional integer array as a parameter and identifies the duplicate values in the array. The function then reports these to user. Call the function from the main function to test it . Sample input and corresponding output:How many rows? 5 How many columns? 2 Lets populate the array: 1 8 6

I have to create a personal resume building tool. Form elements will be used to accept user input which will be assigned to variables. These variable values will make up the content of a new Web page that will be generated when a form button named Create Resume is clicked.

DO NOT USE THE OTHER ANSWERS ON CHEGG, I WANT TO HEAR OTHER DIFFERENT ANSWERS. In order to improve performance, only a subset of ACID properties are implemented in NoSQL databases. Why does the databases's performance decrease if we guarantee all ACID properties?

Here we wonder, can we simulate a fair die using a fair coin. That is, suppose your computer has a fair coin that can be flipped independently for an unbounded number of times. Can we design a procedure that samples a number uniformly random over{1,2, 3, 4,5,6]? This essentially means that we simulate a fair die. Similar to the lecture, you should
image text in transcribed

Computer Graphics Create a surface which looks like a vase using parametric spline curves. For this purpose: 1. Use parametric spline equation of your wish to create a curve. 2. Rotate the curve along X or Y axis to create surface. You can also use any other method to create the surface. 3. Extrude top part of the surface to shorten the surface.

Create an anonymous block that calls both the package units. Use DBMS_OUTPUT statements to display values returned from the program units to verify the data. I am having trouble calling up the procedure and function. Here is the package that was created. CREATE OR REPLACE PACKAGE order_info_pkg IS FUNCTION ship_name_pf (p_basket IN NUMBER) RETURN

im very lost on all this and how to use matlab correctly. he gave us code to base off but even then i dont even know what im looking for if anybody can help thatd be nice 2. Curve Fitting: (23) a) There is a file provided as part of this assignment called "Data02.mat". It is a matlab file that contains the data to be analyzed in this section. The
image text in transcribed

An attribute or combination of attributes that is a foreign key in one relation of a database must be another relation in the database. the primary key of a secondary key of an alternate key of a non - unique attribute or combination of attributes of None of the above.
image text in transcribed

The relationship between the number of sequential gates between flip - flops and the clock cycle time?

Lab 5: Tape for a Turing Machine (Doubly-linked List) This lab is another relatively short exercise in which you will code part of an existing project. In this case, you will be working with a doubly-linked list. To make this topic more interesting, the list that you work on will be part of a Turing Machine. A Turing Machine is a kind of very

(PYTHON) Your task this week is to write a very simple spam classifier in Python. It will classify messages as either SPAM (unwanted) or HAM (wanted). The program will have a set of SPAM_WORDS, words that are known to appear in spam messages. You will also define a spam threshold which reflects the allowed percentage of spam words in the message.

A CSSID is an installation configuration variable for an AP true or false

C++ Ways to play Tic-Tac-Toe Use recursion to find out how many ways there are ?to play 3x3 tic-tac-toe. If two games end in the same final position, but reached there in a different manner, then they are counted as different ways. Simply cout how many ways there are as the only output of the program.
image text in transcribed

CHW 5 . 2 . Graphs: Meme spread in social networks Graphs can be used in mathematics and other fields to represent objects and the connections between them. Here, we will use a directed graph to represent people in a social network and their friend connections with one another. In this directed graph nodes correspond to people. An edge between two
image text in transcribed

Question about a specific data structure. Consider the following data structure for representing a set I of integers. The elements of the set are stored in a doubly linked list of arrays such that: (1) Each element of I occurs in exactly one of the arrays in this list, (2) each array is sorted in increasing order, (3) the number of elements in
image text in transcribed

Which of the following rules does the iSCSI qualified name ( IQN ) naming convention not need to follow? A date code specifying the year and month in which the organization registered the domain of subdomain name The organizational naming authority string, which consists of a valid, reversed domain or subdomain name A colon followed by a string of
image text in transcribed

(20pt) Consider the following grammar: S S$$ S aSa S (1) (10pt) Prove that G is not SLR(1). (Use the definition on the last slide of the Syntax chapter.) (2) (10pt) Construct G, equivalent with G, that is SLR(1). Prove that G is SLR(1). You can use jflap to compute the parse table and show there is no conflict; include the jflap answer (whole

Select the correct definition at right for each of the terms at left (matching): A. Changes to these parameters inside a function will not cause 1. Local Variables ________ the corresponding argument values to change. B. Their values are not allowed to be changed. C. Declared in the body of a function. They are accessible 2. Array ______ only

USE PYTHON PLEASE For this question, you will write two programs that determine if a car should go through an intersection or stop. Your program will prompt the user for the colour of the traffic light at the intersection (a string), the distance to the intersection in meters (a float), and the speed of the car in meters per second (a float). The
image text in transcribed

Please complete the following program. USE C++ Cut and paste your code in the Submit Text field to submit when you are done; or submit your source code (.cpp file). #include using std::cout; using std::cin; int main() { // create a while loop to // 1) ask the user to input a letter. // 2) if the letter is not '0', display the letter. Go back to

This network device gives you the ability to aggressively control how users and applications use your local area networks. node router hub switch
image text in transcribed

QUESTION 40 The severity for DCL02-J is medium high Low none of the above 2 points QUESTION 41 ScheduledExecutor is not an interface of which of the following interfaces? ScheduledExecutorService Executor java.util.concurrent ExecutorService 2 points QUESTION 42 What is a security manager? a Java class that defines a security policy for Java code.

Converting C Functions into MIPS Consider the textbook's implementation of the standard C library function strcpy in assembly language. Implement memset , strlen , strchr , strcat , strstr , and strcmp . Use $a0 through $a3 as necessary for the standard C library's arguments to each function. Return in $v0. Do *not* write a main program. Don't

Marked out of 1.00 3.2-1 Transport-layer demultiplexing. What is meant by transport-layer demultiplexing? Select one: a. Receiving a transport-layer segment from the network layer, extracting the payload, determining the destination IP address for the data, and then passing the segment and the IP address back down to the network layer. b.
image text in transcribed

2. According to the proof of the Kleene's Theorem, find a regular expression for L(M) where M is a DFA given as below pl p2
image text in transcribed

A networking approach where many control functions for managing the movement of data on a network are managed by a central program separately from the network itself is known as: remote network management. software - defined networking. cloud networking. service - oriented architecture. software - as - a - service.
image text in transcribed

Apply a large language model by Producing LLM - based solutions in Microsoft Power Automate Extract: shoe _ agent _ name ( this is Jim ) request _ type ( this is "Order" ) shoe _ brand, shoe _ model, shoe _ quantity customer _ name customer _ street customer _ city customer _ state customer _ zip customer _ phone In addition, you'll assign a shoe
image text in transcribed

on the hard drive? Which of b3de following is a map of all the a. Cluster b3d9 b3d7a1 bez az amp fe 99 C. Master Boot Record Pod Tayofe99 2 ZPE9 d. Master File b307a 10fe99 b3d7 10 fe99 Ofe99 530 7 a 10 fe % MER Male There are maching practical steps that must be afu 101 and protecting evidence is the when collecting of dhe Noma San Set were to wa
image text in transcribedimage text in transcribed

Which aspect of technology encompasses the knowledge, methods, materials, and constituent parts used in creating a particular technic? Technology as technics Technology as a total societal enterprise Technology as a form of human cultural activity Technology as technology

Select the code below that uses CSS to configure an id named "example" that configures small, italic text. Select one: A . example font - size: small; font - weight: italic;
image text in transcribed

Please create a sample list called countrylist.txt and code has to be in python The file countrylist.txt contains a list of countries. Write a program that says "Hello" to every country in country.txt and saves the results in a file called "helloword.txt
image text in transcribed

Notes: One way to write this program would be to simply write a println statement that outputs each line of the song in order. However, such a solution would not receive full credit. Part of the challenge of this assignment lies in recognizing the structure and redundancy of the song and improving the code using static methods. You should not
image text in transcribed

Please show all work. Dont write code, just solve by hand on paper, thank you A set of points is given below S-((19,6), (9,17), (22,10), (6,15), (10,9), (12,10), (2,14), (1,11), (15,12), (8,4)) Chart Title 18 16 14 12 10 6 4 0 10 15 20 25 a) b) c) d) Use Graham Scan to find the convex hull of S. Show your work How many pops your algorithms have to
image text in transcribed

The purpose of the discussion board is to discuss various topics related to the readings in order to enhance your understanding. Therefore, it is important that you read discussion board postings, dont restate what someone has already said, try to further the discussion. It is okay to ask questions, pose ideas, and provide opinions. Post 4 to 6

Will upvote if correct, thanks. 2. [14 points] The initial value in R4 is 0xFFFFFFFF, in R7 is 0x12345678, and the initial value of the condition code NZCV = 0000 STOP MOVS R4, #0x20 MOVS R7, #Ox0 CBNZ R7, DONE MOVW R4, #OxABCD DONE END ; instruction 1 ; instruction 2 ; instruction 3 ; instruction 4 ; instruction 5 What will be the condition code
image text in transcribed

Suppose you are given a set S of n integers. You are also given a black box that returns three elements a,b, c S such that a + b + c = 0 if any such elements exist. Devise an algorithm that uses only one call to the black box to determine if S contains any three integers a,b,c such that a + b = c. (Hint: Construct a set S0 so that the following

Suppose you have M sorted linked lists, each of size N, and you want to combine them into a sorted array. Come up with the most efficient algorithm to do this. What is its time complexity? O A. O(M+N) OB.O(N IgM) O C. (MN) OD. (MN Ig(MN)) O E. (MN Ig(M)) OF. (MN Ig(N))
image text in transcribed

PLEASE USE PYTHON, JAVA OR C++ Problem Description A new and upcoming artist has a unique way to create checkered patterns. The idea is to use an M-by-N canvas which is initially entirely black. Then the artist repeatedly chooses a row or column and runs their magic brush along the row or column. The brush changes the colour of each cell in the

Whats the importance of Computer Architecture? Why studying Computer Architecture?

Networking is _ _ _ _ computers with each other so they can create information advantages and cost efficiencies.

What is a friend function in C++? In what situations are they appropriate?

The Arab Spring uprising saw many social media users in Tunisia, Egypt, Syria, and Bahrain join together to organize protests as part of a digital culture. A . gamer B . harassment C . influencer D . activist
image text in transcribed

Which sorting method among the following guarantees a worst case performance in time (O(N*logN)) while using linear memory (O(N))? Merge sort Shellsort Quick sort Selection sort

Use Raptor for the following problem. We will use loops to process more than one set of input values. Ask for the number of people that we would like to process. Make sure the user inputs a positive number more than 0 for the number of people. You need to continue asking for a valid number of people until valid data is entered.

Indicate when each of the following bindings takes place in Java (language design time, language implementation time, compile time, link time, load time, or runtime). If more than one time is possible, choose the latest possible time. (a) Binding of the long type to a specific number of bytes (i.e., the decision to use a specific number of bytes

NETCONF Protocol uses the data description language, SMI, to specify the syntax, semantics, and structure of the network management data. Question 3 options: True False

Using C language please please i only have 20 min Exercise 2: Print 5 elements from Array of size 10 Exercise Objectives Using for loop Using break Using #define and Array Problem Description Develop a C program that will store 10 integer numbers in array and print just the first 5 numbers using for loop, array, break statement and define to
image text in transcribedimage text in transcribed

For every positive integer a , there is a positive integer b in the interval ( a , 2 a ] ( i . e . , a < b < = 2 a ) such that b is a power of 2 . Prove or disprove

You do not need to write a complete program, all you need is to complete this code using (python/ Functools has been imported ("from functools import *") in all of the tasks for you, you do not need to import them. so you need only to complete the code in this pic NOTE: Use lambda and list comprehension for the implementation Implement the
image text in transcribed

You have inherited a century old farm house and acreage in Montana. You have visited the site and made an inspection. The house needs a great deal of repair work to get it marginally livable. You have itemized the most important things that need to be done and estimated the time required as shown below. The total estimated time is 160 work hours.

In C programming language Develop the main() function which asks the user how many values will be provided, prompts the user for that number of values, and finally calls the PrintValues() function to lists the values for a specified category (as described in part B). Each value must be stored in an array (e.g. values[]), starting with element zero

In functional programming languages,

. Write an entire C++ program that reads a positive integer entered by an interactive user and then prints out all the positive divisors of that integer in a column and in decreasing order. The program should allow the user to repeat this process as many times as the user likes. Initially, the program should inform the user about how the program

Showing 1300 - 1400 of 1500
  • 14 / 15