All Matches

Solution Library

Expert Answer

Textbooks

Search Textbook questions, tutors and Books

Oops, something went wrong!

Change your search query and then try again

Result Not Found

Books FREE
Tutors
Study Help
Ask a Question

Search
Sign In
Register

study help
sciences
fundamentals of biochemistry

Questions and Answers of Fundamentals Of Biochemistry

A certain membrane protein allows phosphate groups to enter a eukaryotic cell.(a) Would you expect the protein to function more like KcsA or more like GLUT1?(b) Phosphate ions enter the cell along
An E. coli cell contains about 2.6 × 108 ions, which constitute about 1% of the mass of the cell, and each ion has an average molecular mass of 40 g.(a) What is the approximate mass of the cell?(b)
Where would the following substances partition in water containing palmitic acid micelles?a. b. +HN-CH-COO
Identify the amino acids that differ from each other by a single methyl or methylene group.
Glutamate, a 5-carbon amino acid, is the precursor of three other amino acids that contain a 5-carbon chain. Identify these amino acids.
The 20 standard amino acids are called α-amino acids. Certain β-amino acids are found in nature. Draw the structure of β-alanine (3-amino-n-propionate).
Calculate the number of possible pentapeptides that contain one residue each of Ala, Gly, His, Lys, and Val.
Identify the hydrogen bond donor and acceptor groups in asparagine.
In some proteins, the side chain of serine appears to undergo ionization. Explain why ionization would be facilitated by the presence of an aspartate residue nearby.
Determine the net charge of the predominant form of Asp at(a) pH 1.0,(b) pH 3.0,(c) pH 6.0,(d) pH 11.0.
Determine the net charge of the predominant form of Arg at (a) pH 1.0,(b) pH 5.0,(c) pH 10.5,(d) pH 13.5.
Some amino acids are synthesized by replacing the keto group (C=O) of an organic acid known as an α-keto acid with an amino group (C=NH+3). Identify the amino acids that can be produced this way
Indicate whether the following familiar objects are chiral or nonchiral:(a) a glove;(b) a tennis ball;(c) a screw;(d) this page;(e) a snowfl ake;(f) a spiral staircase;(g) a shoe.
Patients with Parkinson’s disease are sometimes given L-DOPA (3,4-dihydroxyphenylalanine). What neurotransmitter is produced by the decarboxylation of L-DOPA?
Over time, the glutamine residues of polypeptides are susceptible to deamidation, a reaction in which the amide group is replaced by a carboxylate group. What amino acid is produced when glutamine is
Some hormone-signaling pathways result in the phosphorylation of tyrosine resides in proteins. Draw the structure of a phosphotyrosine side chain.
Which amino acids have side chains that are capable of forming isopeptide bonds?
Identify the amino acid residue from which the following groups are synthesized:a.b.c. O CH-OH CHg-CNHCHCO-
Some bacteria produce poly-γ-glutamic acid, a polymer in which the amino group of each glutamate residue is condensed with the γ-carboxylate group of the adjacent residue. Draw the repeating
Lanthionine is a nonstandard amino acid consisting of two alanine residues linked via their β carbon atoms by a thioether (—S—) linkage. Draw the structure of lanthionine.
Draw the four stereoisomers of threonine as Fischer projections.
Describe isoleucine (as shown in Table 4-1) using the RS system. TABLE 4-1 Covalent Structures and Abbreviations of the "Standard" Amino Acids of Proteins, Their Occurrence, and the pK Values of
Draw the structure of the dipeptide β-alanylhistidine, also known as carnosine.
What is the approximate net charge of carnosine(a) At pH 3,(b) pH 5,(c) pH 7,(d) pH 9?
It has been hypothesized that early life-forms used only eight different amino acids to build small peptides. How many different 10-residue peptides could be constructed from eight amino acids?
Which peptide has greater absorbance at 280 nm?A. Gln–Leu–Glu–Phe–Thr–Leu–Asp–Gly–TyrB. Ser–Val–Trp–Asp–Phe–Gly–Tyr–Trp–Ala
Protein X has an absorptivity of 0.4 mL · mg–1 · cm–1 at 280 nm. What is the absorbance at 280 nm of a 2.0 mg · mL–1 solution of protein X?
You are using ammonium sulfate to purify protein Q (pI = 5.0) by salting out from a solution at pH 7.0. How should you adjust the pH of the mixture to maximize the amount of protein Q that
The blood of individuals with cryoglobulinemia contains proteins, mostly immunoglobulins, that, in contrast to most blood proteins, become less soluble at cold temperatures. Explain why a prominent
(a) In what order would the amino acids Arg, His, and Leu be eluted from a carboxymethyl column at pH 6?(b) In what order would Glu, Lys, and Val be eluted from a diethylaminoethyl column at pH 8?
Determine the subunit composition of a protein from the following information:Molecular mass by gel fi ltration: 200 kDMolecular mass by SDS-PAGE: 100 kDMolecular mass by SDS-PAGE with
Explain why a protein, which has a sedimentation coefficient of 2.6S when ultracentrifuged in a solution containing 0.1 M NaCl, has a sedimentation coefficient of 4.3S in a solution containing 1 M
Explain why the dansyl chloride treatment of a single polypeptide chain followed by its complete acid hydrolysis yields several dansylated amino acids.
Identify the first residue obtained by Edman degradation of cytochrome c from(a) Drosophila,(b) baker’s yeast,(c) wheat germ.
A pentapeptide has the sequence NNKNN (using one-letter symbols for amino acids). Calculate the mass of this peptide, as determined by mass spectrometry, to three significant figures.
Consult Table 5-1 to complete the following:(a) On a plot of absorbance at 280 nm versus elution volume, sketch the results of gel fi ltration of a mixture containing human cytochrome c and
The peptide in Problem 15 was sequenced by tandem mass spectrometry. What are the expected masses of the peptide fragments obtained by this method?Data from problem 15A pentapeptide has the sequence
Explain how you would use salting out to prepare a more concentrated solution of a protein.
What fractionation procedure could be used to purify protein 1 from a mixture of three proteins whose amino acid compositions are as follows?1. 25% Ala, 20% Gly, 20% Ser, 10% Ile, 10% Val, 5% Asn, 5%
Separate cleavage reactions of a polypeptide by CNBr and chymotrypsin yield fragments with the following amino acid sequences. What is the sequence of the intact polypeptide? CNBr treatment 1.
You must cleave the following peptide into smaller fragments. Which of the proteases listed in Table 5-4 would be likely to yield the most fragments? The fewest?NMTQGRCKPVNTFVHEPLVDVQNVCFKE TABLE 5-4
You wish to determine the sequence of a short peptide. Cleavage with trypsin yields three smaller peptides with the sequences Leu–Glu, Gly–Tyr– Asn–Arg, and Gln–Ala–Phe–Val–Lys.
How many peptide bonds are shown in the structure drawn in Fig. 6-7?Figure 6-7 ES
Why would you be unlikely to see an α helix containing only the following amino acids: Arg, Lys, Met, Phe, Trp, Tyr, Val?
Collagen IV, which occurs in basement membranes, contains a sulfilimine bond (colored red in the structure below) that crosslinks two collagen triple helices. Identify the parent amino acid residues
Calculate the length in angstroms of a 100-residue segment of the α keratin coiled coil.
The digestive tract of the larvae of clothes moths is a strongly reducing environment. Why is this beneficial to the larvae?
Is it possible for a native protein to be entirely irregular—that is, without α helices, β sheets, or other repetitive secondary structures?
(a) Is Trp or Gln more likely to be on a protein’s surface?(b) Is Ser or Val less likely to be in a protein’s interior?(c) Is Leu or Ile less likely to be found in a middle of an α helix?(d) Is
Classify the following proteins as α, β, or α/β:(a) KcsA K+ channel (Fig. 10-4)Figure 10-4(b) Thioredoxin (Fig. 23-11)Figure 23-11 Turret (a) Outer helix Selectivity filter Inner helix (b)
Which of the functional groups in Table 1-3 give a molecule a positive charge? Which give a molecule a negative charge?Data from Table 1-3: TABLE 1-3 Major Biological Polymers and Their Component
Does entropy increase or decrease in the following processes?a. b. c. d. N + 3 H 2 NH3
Which reactions tend to be characterized by an increase in entropy: condensation or hydrolysis reactions?
The bacterium Thiomargarita namibiensis—at about 0.1 to 0.3 mm in diameter—is visible to the human eye. How does its size compare to the size of typical prokaryotic cells? How does it compare to
According to molecular sequence data, to which prokaryotic group are eukaryotes more closely related?
(a) Which has greater entropy, liquid water at 0°C or ice at 0°C?(b) How does the entropy of ice at −5°C differ, if at all, from its entropy at −50°C?
Can a process occur if the entropy of the system decreases and the enthalpy increases?
Why is the cell membrane not an absolute barrier between the cytoplasm and the external environment?
Most of the volume of T. namibiensis cells (see Problem 4) is occupied by a large central vacuole. Why were scientists surprised to discover a bacterial cell containing a vacuole?Data from Problem
Rank the water solubility of the following compounds:a. b. c. d. e. HCCH,0CH,
Approximately how many molecules of H2O are in one spoonful of water, assuming that the spoon holds about 18 mL?
Indicate the ionic species of phosphoric acid that predominates at pH 4, 8, and 11.
(a) At any instant, how many water molecules are ionized in 1 L of pure water at pH 7.0?(b) Express this number as a percentage of the total water molecules.
Use Coulomb’s law (Equation 2-1) to explain why a salt crystal such as NaCl remains intact in benzene (C6H6) but dissociates into ions in water.Data from Equation 2-1: U = kq192 Dr
(a) Would phosphoric acid or succinic acid be a better buff er at pH 5?(b) Would ammonia or piperidine be a better buff er at pH 9?(c) Would HEPES or Tris be a better buff er at pH 7.5?
Many foods must be refrigerated to prevent spoiling (microbial growth). Explain why honey (which is ∼82% carbohydrate by weight) resists microbial growth even at room temperature.
Name the following nucleotide. O_ H H N NH N H (P) -0 N N' H OH -
Marble is composed largely of calcium carbonate (CaCO3). Spilling tomato juice on a slab of marble etches (eats away) the surface. Explain what happens in chemical terms.
Rapidly growing Burkholderia bacteria normally produce ammonia as a waste product. The accumulation of ammonia kills mutant bacteria that are unable to also produce oxalic acid. Explain how the
When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base.
Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzed reactions?(a) ATP + GDP → ADP + GTP(b) ATP + GMP → AMP + GTP
Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzed reactions?(a) ADP + CMP → AMP + CDP(b) AMP + ATP → 2 ADP
Explain why the strands of a DNA molecule can be separated more easily at pH > 11.
An enzyme from the human immunodeficiency virus (HIV, which causes AIDS) can synthesize DNA from an RNA template. Explain how this enzyme activity contradicts Crick’s central dogma.
Using the data in Table 3-2, identify restriction enzymes that(a) Produce blunt ends(b) Recognize and cleave the same sequence (called isoschizomers)(c) Produce identical sticky ends.Data from Table
The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the reaction of TaqI with the DNA sequence shown. 5'-ACGTCGAATC-3' 3'-TGCAGCTTAG-5'
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to
By how many nucleotides, on average, do the genomes of two Homo sapiens differ?
Refer to the diagram of pUC18 (Fig. 3-24) to determine which restriction enzymes you could use to insert a gene that would interfere with production of β-galactosidase by the host cell.Data from
Refer to the diagram of pUC18 (Fig. 3-24) to determine which restriction enzymes you could use to insert a gene that would not interfere with ampicillin resistance or production of β-galactosidase
Some RNA molecules are covalently modified by methylation at the N6 position in adenosine residues. Draw the structure of the modified nucleoside.
Would the modified nucleoside described in Question 23 be able to participate in standard Watson–Crick base pairing?Data from Question 23:Some RNA molecules are covalently modified by methylation
The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine is 9.50. Explain this difference.
Use your answer to Problem 27 to determine the relative pK values of N3 in cytosine and in uracil.Data from Problem 27:The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR. ATAGGCATAGGCCCATATGGCATA AGGCTTTATAATAT- GCGATAGGCGCTGGTCAG
Describe the outcome of a chain-terminator sequencing procedure in which (a) Too few primers are present (b) An excess of primers is present
Indicate the ionic species of ammonia that predominates at pH 4, 8, and 11.
Where would the following substances partition in water containing palmitic acid micelles? (a) +H3C—(CH2)11—COO−(b) +H3C—(CH2)11—CH3−.

Showing 400 - 500 of 488

1
2
3
4
5

Get In Touch

About Us
Contact Us
Career
Jobs
FAQ
Campus Ambassador

Company Info

Security
Copyrights
Privacy Policy
Terms & Condition
SolutionInn Fee
Scholarship

Services

Sitemap
Fun
Definitions
Become Tutor
Study Help Categories
Recent Questions
Expert Questions

Copyright © 2024 SolutionInn All Rights Reserved.

Get the SolutionInn - Study Help App