Question: A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this codon in the transcribed mRNA into GUA

A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this codon in the transcribed mRNA into GUA (valine), AUA (isoleucine), CUA (leucine), UGA (stop), UAA (stop), UCA (serine), UUG (leucine), UUC (phenylalanine), or UUU (phenylalanine). According to the neutral theory of evolution, which of these mutations would you expect to be the most likely to be found within a natural population? Explain.

Step by Step Solution

★★★★★

3.38 Rating (160 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

According to the neutral theory of evolution mutations that have little to no effect on an organisms ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Structural Analysis Questions!

All of them pertain to the most recent USA fiscal year unless stated otherwise: use the link below SEC Filings | General Motors Company (gm.com) ACCOUNTING CHANGES/ERROR CORRECTIONS Were there any...

Examine the genetic code in Table 16.1. Are point mutations in the first, second, and third positions of a codon equally likely to cause a change in the amino acid sequence of a protein? What type of...

There is information on flexible work plans such as flextime, working from home, shortened work weeks, core time, job-sharing, etc. From a Human Resource perspective, which do you feel would be the...

In wild type E. coli a 3'- G-T-A- 5' triplet of DNA nucleotides is transcribed into a codon that is translated into an amino acid in a functioning polypeptide. If there is a nucleotide pair...

What is the nucleotide sequence on the DNA template strand that yields the 5 ' CUA 3 ' codon for leucine on the mRNA? GIve the code in the 5 ' - 3 ' direction. TAG AUC CTA GAT CUA

In Java, write a program called DNAToProtein.java: In this program you are going to pair a DNA codon (each codon is three letters) from the text file called codon.txt to an amino acid abbreviation...

Although 61 codons specify the 20 amino acids, most species display a codon bias. This means that certain codons are used much more frequently than other codons. For example, UUA, UUG, CUU, CUC, CUA,...

You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below: 3CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5 Additional tools are provided below. a)...

""" Code file for M269 20J TMA01 Question 3. Student version 4: 24/03/20 """ """ The following table determines which amino acid is produced by a particular 3-base DNA codon. It uses a Python...

The technique of Western blotting can be used to detect proteins that are translated from a particular mRNA. This method is described in Chapter 20 and also in experimental question E5. Let's suppose...

In Problem determine which of the equation specify function with independent variable x. For those that do, find the domain. For those that do not, find a value of x to which there corresponds more...

Find the transfer function Vo(s)/Vi(s) for the network shown in fig. Briefly.

Explain the areas constituting the prospects of Production Planning and Control (PPC).

CASE STUDY ACCOUNTING ESTIMATES The board of directors of Good Company Ltd has resolved to change the companys accounting policy for capitalising gains or losses on its cash flow hedges recognised in...

A bottle at 325 K contains an ideal gas at a pressure of 162.5 10 3 Pa. The rubber stopper closing the bottle is removed. The gas expands adiabatically against P external = 120.0 10 3 Pa, and some...

Predict the product and draw the mechanism for each of the following reactions: a. b. c. 1) LAH 2) H20 1) LAH 2) H20

Predict the product and draw the mechanism for each of the following reactions: a. b. c. ? 1) LAH 2) H20

/ / . . . ( Previous code ) / / Function to send a specified number of hybrid RREQ packets void SendHybridRREQ ( Ptr source, Ipv 4 Address destAddress, uint 3 2 _ t numPackets ) { for ( uint 3 2 _ t...

which of the following is usually the lowest? a.) after-tax cost of debt b.) before-tax cost of debt c.) cost of preferred stock d.) cost of common stock e.) Marginal cost of capital

Introduction to MIT681 This is the Capstone class for graduating MSIT students. The class is designed to exercise your IT skills and abilities and summarize all of your learning from IGU MSIT program...