Chemistry Questions and Answers July 03, 2020

Define corrosion. Write the factors that can affect the corrosion.

What is rust? Illustrate the formation of rust.

What is cement? Write down the main composition of cement.

Define the electron, proton and neutron with example.

Postulates the solar system atom model with its limitation.

State Aufbau principle Show the electronic configuration of the followings atoms 9 F, 24Cr, 11Na and 29Cu

Define chemical bond. Explain the ionic bond with example.

Write down the characteristics of transition element.

Deduce the first order rate constant equation by considering the reaction nC Product.

Define half-life. Prove that the half-life of 2 nd order reaction is inversely proportional to the initial concentration of the reactant.

For a certain first order reaction t12 is 100 sec. How long will it take for the reaction to be completed 80

The molecular formula of an unknown peptide is C 20 H 34 N 6 O 6 . NMR spectra, taken in d6-DMSO/D2O on our 600 MHz NMR are provided. DMSO gives a proton signal at 2.49 and a carbon signal at 40 ppm. In addition to drawing and labeling the structure, answer or address the following points. The MS/MS data was acquired in (+) ESI mode and the

Integs. x 10 1.50 1.25 1.00 0.75 0.50 0.25 0.0b 137.9 242.9 224.9 194.206.9 00 250 300 332.1 350.1 356.1 350 MS2(455.3), 0.20.7min (1040) 400 437.2 420.2 450 mz

A hypothetical weak base has K 5.0 x 10. Calculate the equilibrium concentrations of the base, its conjugate acid, and OH in a 0.15 M solution of the base. What is the pH of the solution B molL HB) molL OH molL pH Show Approsch Hide Tutar. Steas Submit

A major component of gasoline is octane (C,H). When octane is burmed in air, It chemically reacts with oxygen gas (0,) to produce carban dioxide (Co.) and water (H,0). What mass of octane is consumed by the reaction of 2.6 g of oxygen gas Round your answer to 2 significant digits.

Item Loan Amont Contractual Rate Conversion Periods Life of Loan (years) Method of Payment Closing Costs Points (i) (iv) Calculate the amount of loan payments of Bank A. 2,154.61 2,116.25 a. 2,212.37 2,162.33 e. None of the answers are correct C. a. Enter Response Here (ii) Calculate the amount of loan payments of Bank B. 2,152.54 2,247.25 C.

5.8 In a pseudo first order hydrolysis of ester in water, the following results were obtained ts 30 60 90 Estermol L 0.31 0.55 0.17 0.085 (i) Calculate the average rate of reaction between the time interval 30 to 60 seconds. (ii) Calculate the pseudo first order rate constant for the hydrolysis of ester.

Write this report properly by hand written.

Name of the Experiment Estimation of copper in the supplied solution using standardized sodium thiosulphate solution. Theory When KI is added to a solution of copper sulfate, white cuprous iodide (Cuzl2) is precipitated and an equivalent amount of iodine is liberated. This free iodine is titrated against standard solution of sodium thiosulphate

Write the equilibrium constant expression, K, for the following reaction. Please enter the compounds in the order given in the reaction. If either the numerator or denominator is blank, please enter 1 HCN(aq) + H2O(l) H3O+(aq) + CN-(aq) K =

Name of the Experiment Estimation of copper in the supplied solution using standardized sodium thiosulphate solution. Theory When KI is added to a solution of copper sulfate, white cuprous iodide (Cu12) is precipitated and an equivalent amount of iodine is liberated. This free iodine is titrated against standard solution of sodium thiosulphate

Name of the Experiment Estimation of copper in the supplied solution using standardized sodium thiosulphate solution. Theory When KI is added to a solution of copper sulfate, white cuprous iodide (Cuzl2) is precipitated and an equivalent amount of iodine is liberated. This free iodine is titrated against standard solution of sodium thiosulphate

The reaction C(s) 2H, (g) CH, (g) 0.263 at 1000. K. Calculate he total pressure at equilibrium when 4.027 g of H, and 22.86 g of C) are placed in a 9.21 L flask and heated to 1000. K. has Kp atm Pastal Calculate the total pressure when 4.027 g of H, and 8.652 g of C(s) are placed in a 9.21 L flask and heated to 1000. K. alm Piotat

Problem 4 Draw the mechanism for the cyclic amine reaction in the boxes below Step 1 Draw the oxide product that forms after KMNO4 treatment (no mechanism) Hint what kind of reagent is KMN04 This chemistry could atso be dane with hydrogen peroxide and peroxyacid. Maybe with high pressure of 02 as wel There actualy is not a mechanism for this first

A total of 1.569 F of electricity (1 F 1 mol e) was required to electrodeposit all of the Zn and Co from a solution of ZnSO. and CoSO.. The mixture of Zn and Co that was deposited had a mass of 48.00 g. Calculate the masses of ZnSO, and CoSO, present in the original solution.

(7) Complete the following outlined reactions by providing the major organic product expected in cach case. (For multistep processes, give the final product.) T. r. Na Na 1)2 L HCKconc) 2) Cuc eat H,SO, Mg ether major

Weve dealt with the molecular diagram of diatomic molecules. However, conceptually the problem is much more difficult when dealing multiatomic molecules. Below is shown the molecular orbital diagram for water o 2s o 2p energy n 2p (nonbonding) 1 1 2p 1s 18 2s H H o 2p o 2s H,0 How many bonds are predicted from this molecular orbital diagram b.

Shown below is the structure of mevalonate, a precursor of cholesterol. Select all the atoms of cholesterol that correspond to C1 of mevalonate. Double click to select bonds. You must identify all of the isoprene units. Gray C white H red 0 blue N dark green Cl brown Br light green F purple I yellow S orange P.

What is the activity coefficient for each ion at the given ionic strength at 25 C Activity coefficients at various ionic strengths can be found in this table. so (H 0.01 M) y Incorrect 0.145 Al (H 0.1 M) Y Incorrect Pr (u 0.005 M) Y Incorrect 0.964 (CH, CH, ), NH (u 0.05 M) Y

From standard reduction potentials, calculate the equilibrium constant at 25 C for the reaction 2MNO, (aq) 10Cl (ag) 16H (aq) 2MN2 (aq) 5Cl2 (g) 8H20 (1) Express your answer using one significant figure. K 1025

Reagents C6H5CHO b. NaOH, ethanol Pyrrolidine, cat. H d. H2CCHCN e. H30 h. BRCH2CHCH2 Na OEt, ethanol j. Br2, H k. K tBuO . i. C. 1. CH2(CO2ET)2 CH2CH2CN f. LDA m. heat g. ELOC(0)CO2ET Select reagents from the table to synthesize this compound from cyclopentanone. Enter the letters of the chosen reagents, in the order that you wish to use them,

8. Balance the following redox equations. Show the half reactions of the oxidation and reduction process. a) NH3 Cu0 Cu N2 H2O b) C2H6O KMNO4 H2SO4 C2H4O2 K2SO4 MnSO4 H2O

3. Provide a synthetic route to each of the following compounds. a. H2NglyphealaCO2H from the constituent aminoacids using a solid phase synthesis b. HO. NH2 N. from and anything else C. Alanine from glycine F3

Show full reaction mechanism, full structure of intermediates and abbreviation and any observed selectivity.

a) Provide detailed reaction mechanism for the transformation of epoxide 4 into cyclopentane 5, showing full structure of intermediates and abbreviations used and state any observed selectivity. Also make reference to pKa and Lewis acid and basic species. PhO,S e OBn ,O8n 4 HO H. b) Show full rection mechanism for the stransformation of alcohol 10

The enantiomer in the below reaction is the predominant product of the enantio-selective transformation, it is extremely unlikely that 100% enantiomeric excess would be observed in the product. There are several ways in which the "incorrect" enantiomer of ethyl 3-hydroxybutyrate might form as a miner side-product in this reaction. Based on this,

Na BHy L Ta B Catalyst Trcansition stali OH ethyl 3 tycbuony butyonaty Single enautiomer)

Cobalt(II) ions (Co2(aq)) react with 6 equivalents of a ligand (L) to from the complex cation CoL,2 (aq) with K 3.86 105. To verify this, an electrochemical concentration cell is constructed. To one half of the cell, the initial concentration of Co2(aq) is 0.0100 M and the initial concentration of L is 1.00 M. This solution is allowed to reach

.

Like all known nucleic acid polymerases in nature, eukaryotic DNA polymerase delta synthesizes DNA O different, depending on whether the cell is prokaryotic or eukaryotic. 3 to 5 only. both 5 to 3 and 3 to 5. 5 to 3 only. O from left to right only.

Below is an image of oxaloacetate. Please draw the glutamate side chain beside it. Explain why glutamate may act as a substrate analog. OH ,Below is an image of oxaloacetate. Please draw the glutamate side chain beside it. Explain why glutamate may act as a substrate analog. OH

2. a. Provide mechanisms andor products for the following transformation. Me Me (.5 equiv) H NEt, CHO Me TSOH PhH, heat Me ,2. a. Provide mechanisms andor products for the following transformation. Me Me (.5 equiv) H NEt, CHO Me TSOH PhH, heat Me

Which of the following compounds undergoes Hofmann degradation A. . CN NH2 . D. NHCH3 E. none of the above

Provide the appropriate reagents or product in the following examples. 1.0s04, TBHP, HOTHF 2. TSOH, acetone, PhH, heat 3. AICI. CHCOCI, CHCl 1. BzOOBz, NBS, CCIA 2. Mg, THF then PdL PhBr 3. HNO, HSO4 4. Zn, HCI OMe

Calculate the amount of air required to completely burn 1 kg of Octane (C8H18). If the amount of air is increased by 25%, calculate the equivalence ratio and the gravimetric analysis of the products.

Provide a figure showing the apparatus required to perform a hydrogenation reaction at 1atm. H2, without the need for specialist glassware/equipment. (The apparatus should be suitable for performing the reaction in a fumehood). (ii) Provide a figure showing the Parr shaker hydrogenation apparatus required to perform a hydrogenation at 4 atm. H2.

(d) A polymer chemist wants to synthesize poly(lactic acid) via polycondensation (molecular weight of lactic acid 90.1 gmol). (0) What is the molar mass at a conversion of 99 (neglect end groups) (ii) Suggest an analytical method to obtain the conversion of the polymerisation process.

CH 1. H3CCECO, 2. H,O What is the product of the following reaction CHs HO CH, HO. CH HO. CH OH CH CH3 b) CH, CHy a)

Suggest mechanisms for this substance CH3 CH3 OH OH CH3 CH3 ZI IZ

Suggest mechanisms for this substance CI Z Z N

Which of the following is a strong acid O acetic acid hydrochloric acid Ohydrofluoric acid O phosphoric acid

Buffer Preparation AcidBase Reactions An aqueous solution contains 0.496 M hydrocyanic acid. Calculate the pH of the solution after the addition of 2.18x10 2 moles of sodium hydroxide to 125 mL of this solution. (Assume that the volume does not change upon adding sodium hydroxide) pH Submit Answer Retry Entire Group 8 more group attempts

An aqueous solution contains 0.498 M ammonia. Calculate the pH of the solution after the addition of 3.30x102 moles of hydrobromic acid to 155 mL of this solution. (Assume that the volume does not change upon adding hydrobromic acid.) pH Submit Answer Retry Entire Group 8 more group attempts remaining

An aqueous solution contains 0.496 M hydrocyanic acid. Calculate the pH of the solution after the addition of 2.18x102 moles of sodium hydroxide to 125 mL of this solution. (Assume that the volume does not change upon adding sodium hydroxide) pH Submit Answer Retry Entire Group 8 more group attempts remaining

TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA, what is its complementary strand A) For this DNA fragment (from 5 to 3) (1 mark) B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI (0.5 marks) C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme

Complexes of the general formula Fe(CO)5x (PR3)x are long known. The bimetallic Fe2(CO)9 reacts with triphenylphosphine in refluxing diethyl ether to afford a monosubstituted product Fe(CO)4(PPh3) with a trigonal bipyramid geometry. (a) Draw the possible isomers for the monosubstituted product Fe(CO)4(PPh3). (b) Determine the point group for each

Q3 An ethanol water feed holding 20 mol ethanol, 25 saturated gas, is to be separated into a distilate holding 75 mol and a bottoms holding 2 mol ethanol in a distillation column equipped with a partial reboiler and total condenser. The reflux ratio is set to 2.5 and the overall column efficiency can be estimated to 45. (a) How many physical

Dave is considering quitting smoking. Assume that Dave lives three periods (indexed by 0,1,2), and that he might quit in period 0 or in period 1. If he does not quit, he will receive a consumption value of 3 in each of the first two periods, then consumption 30 in the third period. If Dave decides to quit he will receive a consumption value of 3

Consider the following reaction 2Sb2S (s) 6PBO2 (s) 2SbzOs (s) 6PbS (s) 30 (g) a) Calculate the mass (in grams) of PbS that is produced when 0.675g of SbzS3reacts with 0.803g of PbO2. b) If only 0.500 g of PbS is produced, what is the percent yield for the reaction

Question 15 Which of the following processes shows a decrease in entropy of the system Not yet answered Select one Points out of O a. 2 NO(g) 2 N2(g) O2(g) 1.00 Flag O b. COBr(g) Co(g) Brz(g) question O c. CH,OH(I) co(9) 2H2(g) O d. KBro,(s) K (aq) Bro, (aq) e. None of these will show a decrease in entropy.

Correctly balance given these two chemical names choose the correct choice w the correct coefficients in the order of the chemicals aluminum sulfite bismuth (V) permanganate bismuth salt aluminum salt 5, 3 3, 5 12, 10 6, 5 10, 3 20, 6 5,6 3. 10

3. You are asked to prepare financial statements for your company. IFRS requires that both cost and fair value of all financial instruments be reported in the notes to the financial statements. However, when you are gathering information about the fair value of your companys debt investment, you find that the debt does not have a quoted price in

Devise a synthesis for the following compounds from benzene, any alcohol with four or fewer carbos, and any other required reagent NH 0 LOH .N. CN

What product would be expected in this reaction 3D .C CH,ONH, HO OCH3 H HO NOCH, HO OCH3 B OCH H,NOCH, HO OCH3 HO OCH3 D

Consider the following reaction (DPPE structure below) F. B(OH)2 F Ni(OTf)2 DPPE K2CO3 () Give the product of the reaction and suggest a plausible catalytic cycle giving the number of delectrons and the oxidation state of Ni in each intermediate.

The halflife for the alpha decay of 226Ra to form 222Rn is 1.6010 y. Suppose the energy of the alpha particle is 4.50 MeV and that 1.09 g of 226Ra, freed of any other radioactive materials, were placed in a calorimeter containing 11.3 g of water, initially at 21.5C. Calculate the temperature the water would reach after 1.07 hour. Neglect the heat

Sometimes in lab we collect the gas formed by a chemical reaction over water. This makes it easy to isolate and measure the amount of gas produced. Suppose the H2 gas evolved by a certain chemical reaction taking place at 35.0 C is collected over water, and the final volume of gas in the collection tube is measured to be 39.5 mL. Calculate the

A 1.5 kg sample of -brass contains 0.45 kg of Zn, and the rest is Cu. The atomic weight of copper is 63.5 and zinc is 65.4. Write down the concentration of copper in -brass, in wt%, WCu. Find the concentrations of copper and zinc in the -brass, in wt%, XCu and XZn.

23. Organize the carboxylic acid derivatives below in order of decreasing reactivity with a nucleophile. (most reactive least reactive) CI 1 3 3 1 2 4 3 4 1 2 4 3 1 2 O 4 1 3 2

Hypothetical high temperature crystal phases of l2 and CO2 show the unit cell represented by the plan view below. What is the unit cell type a) b) Draw a clinographic projection of the unit cell. c) Give a possible explanation for why the molecules can be represented by a single point in the unit cell. d) What is the basis, assuming the molecular

1. Match each term in Column A with the appropriate statement in Column B. A 1. Presentment 2. Dishonor 3. Notice of dishonor 4. Accommodation party 5. Protest 6. Primary party 7. Acceptor 10. Endorser 8. Unconditional liability 9. Conditional liability i. e. h. j. a. B One who signs an instrument for the purpose of lending hisher name and credit

1. Consider the system of equations Ax b described by 2x2 X2 (3k 4) (k 1)x2 X1 where k is an unknown constant. X3 (k1)x3 2 1 4(k1) (a) You should not need to do any row operations on an augmented matrix to answer the following questions i. For what value of k does the system have an infinite number of solutions For that value of k, describe

365 g of C9H20 are burned with 186 g of O2 to obtain CO2 and H2O. Balance the chemical equation. a) What is the limiting reactant? and how many L of CO2 are obtained? b) How many g of CO2 are formed and how many g of water are obtained? c) How many grams of excess reagent are left? d) how many moles, atoms of c and h are there in the initial

A gas at 25C exactly fills a container whose volume, previously determined, is 1.05 x 10 3 cm3. The container plus gas are weighed and determined to have a mass of 654.2 g. If all the gas is removed from the container, it has a mass of 652.8 g. Calculate the density of the gas at 25C.

Phosphorus is reacted with excess chlorine to obtain a compound whose mass percent composition is 14.5% P. Suppose 10 g of phosphorus is mixed with 135 g of chlorine. a) What is the limiting reagent? b) How many grams of excess reagent remain? c) How many moles of the excess element are left? d) How many grams of the product are formed?

An 85.5 g sample of CuCl2 dissolves in 74.6 g of water. What is the mass% of CuCl2 and water in this solution?

Calculate the empirical formula for monosodium glutamate if it has the following percent composition by mass: 35.51% C; 4.77% H; 37.85% O; 8.29% N; 13.60% Na. If its molar mass is 169 g, what is its molecular formula?

Balance the following reaction: C9H20(g) + O2(g) = CO2(g) + H2O(g). If you initially have 130 g of hydrocarbon 85 g of oxygen according to the previous reaction. a) What is the limiting reactant? b) How many grams of CO2 are formed? And how many moles of CO2 do those grams represent? c) How many liters of water are formed? d) How much of the

An unknown protein was determined using the following method: Bradford method Reagents Stock Bradford reagent: Dissolve 100 mg Coomassie Brilliant Blue G250 in a mixture consisting of 100ml of 85% phosphoric acid, 50ml of 95% ethanol and 50ml 1M NaOH. Store at 4C until precipitation occurs, at which point it is discarded. Working Bradford reagent:

Blank Tube 1 Tube 2 Tube 3 Tube 4 Tube 5 Unknown Distilled H20 1.0 ml 0.9ml 0.9ml 0.9ml 0.9ml 0.9ml 0.9ml 0.25 mgml BSA 0.1 ml 0.5 mgml BSA 0.1 ml 0.75 mgml B SA 0.1 ml 1.0 mgml BSA 0.1 ml 1.25 mgml B SA 0.1ml Unknown 0.1ml protein Working 4.0ml 4.0ml 4.0ml 4.0ml 4.0ml 4.0ml 4.0ml Bradford

Consider the titration of 50.0 ml of 0.100 M sodium glycinate, H2NCH2CO2Na, with 0.100 M Hcl. Calculate the ph at the second equivalence point

Balance the following reaction: C9H20(g) + O2(g) = CO2(g) + H2O(g) and indicate: If you initially have 130 g of hydrocarbon 85 g of oxygen. a) What is the limiting reactant? (do the math) b) How many grams of CO2 are formed? c) How many moles of CO2 do those grams represent? d) How many liters of water are formed and how much of the excess reagent

Four liquids are described in the table below. Use the second column of the table to explain the order of their freezing points, and the third column to explain the order of their boiling points. For example, select 1 in the second column next to the liquid with the lowest freezing point. Select 2 in the second column next to the liquid with the

18) The synthesis of aspirin occurs by a mechanism: a) addition b) elimination c) substitution d) addition-elimination 19) during the synthesis of iodovanillin, what is the function of NaOCI? a) To dissolve the vanillin b) To reduce the iodide ion c) To oxidize the iodide ion d) To acidify the sample e) To provide chloride ion 20) During the

Your answer is partially correct. The following amine can be prepared from either an alkyl halide (using NaCN) or from a carboxylic acid. Draw the structures of both possible starting materials. NH2 Draw a suitable alkyl halide H,C Edit Drawing Draw the carboxylic acid H,C HO

11. In the following compounds list the different protons in NMR and the splitting patterns for each 2H2 2H2CH2 CH3 2CI 2Ar (Ar benzene ring)

- Important feature of skin absorption. Which of these options is correct: a) Hydrophilicity b) Lipophilicity c) None is correct -The degree of ionization affects. Which of these options is correct: a) The water/lipid partition coefficient b) solubility c) Both are correct

-Both the unmetabolized parent compound and its metabolite can cause a response or effect. Is this statement true or false?

The Reidberg equation is suitable for hydrogen-like atoms with a Z- proton nuclear charge and a single electron. Use this equation and calculate the second ionization energy of a helium atom. Given that the first ionization energy of a hydrogen atom is 13.527eV

Calibration of a micropipette is important to minimize the occurrence of predictable random errors, such as voltage variations: a) True b) False

A student scientist prepares a citrate buffer solution and for this weighs 3.19 grams of Na2C6H6O7 and calibrates to 250 mL (flask A) and weighs 2.45 grams of NaC6H7O7 and calibrates in another flask (B) to 250 mL. Subsequently, the student measures 132 mL of A and makes up to 250 mL with B. a)What is the pH of said solution?

A chemist must prepare 450. mL of 35.0 mM aqueous potassium dichromate (K, Cr,0,) working solution. Shell do this by pouring out some 0.490 M aqueous potassium dichromate stock solution into a graduated cylinder and diluting it with distilled water. Calculate the volume in mL of the potassium dichromate stock solution that the chemist should pour

Ammonium phosphate ((NH,) PO4 is an important ingredient in many solid fertilizers. It can be made by reacting aqueous phosphoric acid (H, PO,) with liquid ammonia. Calculate the moles of ammonia needed to produce 2.1 mol of ammonium phosphate. Be sure your answer has a unit symbol, if necessary, and round it to the correct number of significant

A gas mixture contains each of the following gases at the indicated partial pressure. N2 219 torr O2 109 torr He 249 torr What is the total pressure of the mixture Express your answer in torr to three significant figures. Pressure torr

40) Problem Set 11 (Ch 11) Exercise 11.69 Enhanced with Feedback 10 of 19 I Review I Constants I Periodic Table Part A MISSED THIS Watch KCV 11.4, IWE 11.8 Read Section 11.8. You can click on the Review link to access the section in your e Text. What is the molar mass of the gas An experiment shows that a 254 mL gas sample has a mass of 0.428 g

54) Problem Set 15 (Ch 15) Exercise 15.91 16 of 17 I Review I Constants I Periodic Table Part A Consider the reaction Fe(ag) SCN(ag) FESCN2(aq) A solution 1.4x103 M and initial SCN 8.5x104 M. At equilibrium, FeSCN 1.6x104 M. made containing initial Fe Calculate the value of the equilibrium constant. Hint Use the chemical reaction stoichiometry

Draw a complete synthesis from starting material. List out all solvents and reagents used and draw the intermediate structures. Name all five of the structures.

Design a buffer that has a pH of 8.06 using one of the weak acidconjugate base systems shown below. Weak Acid Conjugate Base Ka pKa HC204 C20,2 6.4 x 105 4.19 H2PO4 HPO,2 6.2 x 108 7.21 HCO, co,2 4.8 x 1011 10.32 How many grams of the potassium salt of the weak acid must be combined with how many grams of the potassium salt of its conjugate base,

A 0 AOA Vitamins C is the storage function of the liver True False 3040 of all type 1 DM patients develop nephropathy in years 20 30 40 50 The growth hormone is in plasma glucose on the DM rise fall

Disorder of urine volume is Ferquency haematuria oliguria nausea ALT is the also called GPT True O False The working cells of the liver are Known as hepatocytes True False

These organic compounds in lipids are O polar molecules non polar molecules eating a diet rich in red meat that reduce uric acid True false Triglyceride molecule can be formed by amino acids True False

Traverse Company manufactures and sells women's skirts. Each skirt (unit) requires 2.5 yards of cloth. Selected data from Traverse's master budget for the next quarter are shown below: Each unit requires 1.5 hours of direct labor, and the average hourly cost of Traverse's direct labor is $10. What is the cost of Traverse Company's direct labor in

Calculate the pH of 0.010 M His if His is obtained from a monobasic acid. Note His is an amino acid of histidine. Answer Choices (A) 11.74 () 9.86 () 12.95 (D) 10.63

What is the product formed when 2bromo2methylpropane reacts with propyne in presence of NaNH, Answer Choices (A) 4,4dimethylpent2yne (B) 2,2dimethylhex3yne (C) 2methylprop1ene (D) No reaction

1- The contact of phenol with the skin produces a systemic effect and the headache when inhaling vapors of some solvent is a local effect. This statement is true or false. 2- The degree of absorption, distribution and excretion is determined by physicochemical properties, transport and chemical potential gradients. This statement is true or false.

The formation of an epoxide as an intermediate and its subsequent opening and generation of an OH substituent is a type of reaction catalyzed by transferases. This statement is true or false.