New Semester
Started
Get
50% OFF
Study Help!
--h --m --s
Claim Now
Question Answers
Textbooks
Find textbooks, questions and answers
Oops, something went wrong!
Change your search query and then try again
S
Books
FREE
Study Help
Expert Questions
Accounting
General Management
Mathematics
Finance
Organizational Behaviour
Law
Physics
Operating System
Management Leadership
Sociology
Programming
Marketing
Database
Computer Network
Economics
Textbooks Solutions
Accounting
Managerial Accounting
Management Leadership
Cost Accounting
Statistics
Business Law
Corporate Finance
Finance
Economics
Auditing
Tutors
Online Tutors
Find a Tutor
Hire a Tutor
Become a Tutor
AI Tutor
AI Study Planner
NEW
Sell Books
Search
Search
Sign In
Register
study help
medical sciences
biology
Genetics Analysis And Principles 5th Edition Robert Brooker - Solutions
What is the difference between an autonomous and a nonautono-mous TE? Is it possible for nonautonomous TEs to move? If yes, explain how.
An operon in the bacterium Salmonella typhimurium has the following arrangement:The promoter for this operon is contained within a TE. The H2 gene encodes a protein that is part of the bacterial flagellum. The rHl gene encodes a repressor protein that represses the HI gene, which is found at
The occurrence of multiple transposons within the genome of organisms has been suggested as a possible cause of chromosomal rearrangements such as deletions, translocations, and inversions. How could the occurrence of transposons promote these kinds of structural rearrangements?
Which steps in the double-strand break model for recombination would be inhibited if the following proteins were missing? Explain the function of each protein required for the step that is inhibited. A. RecBCD B. RecA C. RecG D. RuvABC
Is homologous recombination an example of mutation? Explain.
What are recombinant chromosomes? How do they differ from the original parental chromosomes from which they are derived?
In the Holliday model for homologous recombination (see Figure 19.2), the resolution steps can produce recombinant or nonrecombinant chromosomes. Explain how this can occur.
What is gene conversion?
Make a list of the differences between the Holliday model and the double-strand break model.
Briefly explain how McClintock determined that Ds was occasionally moving from one chromosomal location to another. Discuss the type of data she examined to arrive at this conclusion.
In the data of Figure 19.9, is the solid red phenotype due to chromosome breakage or due to the excision of a TE and chromosomal rejoining? Explain how you have arrived at your conclusion.
As discussed in the experiment of Figure 19.9, the presence of a transposon can create a mutable site or locus that is subject to frequent chromosome breakage. Why do you think a transposon creates a mutable site? If chromosome breakage occurs, do you think the transposon has moved somewhere else?
In your own words, explain the term transposon tagging.
Tumor-suppressor genes are normal human genes that prevent uncontrollable cell growth. Starting with a normal laboratory human cell line, describe how you could use transposon tagging to identify tumor-suppressor genes. Note: When a TE hops into a tumor-suppressor gene, it may cause uncontrolled
Gerald Rubin and Allan Spradling devised a method of introducing a transposon into Drosophila. This approach has been important for the transposon tagging of many Drosophila genes. They began with a P element that had been cloned on a plasmid. Using cloning methods, they inserted the wild-type
Make a list of the similarities and differences among homologous recombination, site-specific recombination, and transposition.
If homologous recombination could not occur, what would be the harmful and beneficial consequences?
Based on your current knowledge of genetics, discuss whether or not you think the selfish DNA hypothesis is correct.
Discuss three important advances that have resulted from gene cloning.
Write a double-stranded sequence that is 20 bases long and is palindromic.
Explain and draw the structural feature of a dideoxyribonucleotide that causes chain termination.
Starting with a sample of RNA that contains the mRNA for the (β-globin gene, explain how you could create many copies of the (β-globin cDNA using reverse transcriptase PCR.
What type of probe is used for real-time PCR? Explain how the level of fluorescence correlates with the level of PCR product.
Let's suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response element to a sequence of DNA that is 20 bp in length with the following
Site-directed mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Let's suppose that you are interested in the
Let's suppose you have recently cloned a gene, which we will call gene X, from corn. You use a labeled DNA strand from this cloned gene to probe genomic DNA from corn in a Southern blot experiment under conditions of low and high stringency. The following results were obtained:What do these results
Southern and Northern blotting depend on the phenomenon of hybridization. In these two techniques, explain why hybridization occurs. Which member of the hybrid is labeled?
Table 20.3 describes the cleavage sites of five different restriction enzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 20.1. The efficiency of sticky ends binding together
In Southern, Northern, and Western blotting, what is the purpose of gel electrophoresis?
What is the purpose of a Northern blotting experiment? What types of information can it tell you about the transcription of a gene?
Let's suppose an X-linked gene in mice exists as two alleles, which we will call B and b. X-chromosome inactivation, a process in which one X chromosome is turned off, occurs in the somatic cells of female mammals (see Chapter 5). Allele B encodes an mRNA that is 900 nucleotides long, whereas
The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 16) produces mRNAs from the same gene that have different lengths. A Northern blot is shown here using a DNA probe that is
Southern blotting can be used to detect the presence of repetitive sequences, such as transposable elements, that are present in multiple copies within the chromosomal DNA of an organism. In the Southern blot shown here, chromosomal DNA was isolated from three different strains of baker's yeast,
In Chapter 8, Figure 8.7 describes the evolution of the globin gene family. All genes in this family are homologous to each other, though the degree of sequence similarity varies depending on the time of divergence. Genes that have diverged more recently have sequences that are more similar. For
In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other individual suffered from a disease known as thalassemia, which involves a defect in hemoglobin. In the Western blot, the gel blot
Let's suppose a researcher was interested in the effects of mutations on the expression of a protein-encoding gene for a protein that is 472 amino acids in length. This protein is expressed in leaf cells of Arabidopsis thaliana. Because the average molecular mass of an amino acid is 120 Da, this
Explain the basis for using an antibody as a probe in a Western blotting experiment.
Describe the important features of cloning vectors. Explain the purpose of selectable marker genes in cloning experiments.
Starting with pig cells and a probe that is a labeled DNA strand from the human (3-globin gene, describe how you would clone the (3-globin gene from pigs. You may assume that you have available all of the materials needed in a cloning experiment. How would you confirm that a putative clone really
A cloned gene fragment contains a regulatory element that is recognized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional activation by this transcription factor. To study this effect, you conduct a gel retardation assay
Describe the rationale behind a gel retardation assay.
Certain hormones, such as epinephrine, can increase the levels of cAMP within cells. Let's suppose you pretreat cells with or without epinephrine and then prepare a cell extract that contains the CREB protein (see Chapter 15 for a description of the CREB protein). You then use a gel retardation
A gel retardation assay can be used to study the binding of proteins to a segment of DNA. In the experiment shown here, a gel retardation assay was used to examine the requirements for the binding of RNA polymerase II (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly
As described in Chapter 15 (Figures 15.7 and 15.8), certain regulatory transcription factors bind to DNA and activate RNA polymerase II. When glucocorticoid binds to the glucocorticoid receptor (a regulatory transcription factor), this changes the con-formation of the receptor and allows it
In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase 1 to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp
Explain the rationale behind a DNase I footprinting experiment.
How does gene cloning produce many copies of a gene?
In your own words, describe the series of steps necessary to clone a gene. Your answer should include the use of a probe to identify a bacterial colony that contains the cloned gene of interest.
What is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.
What is a DNA library? Do you think this is an appropriate name?
Some vectors used in cloning experiments contain bacterial promoters that are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and express the gene in bacterial cells. These are called expression vectors. If you wanted to express a
Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the techniques of dideoxy DNA sequencing or site-directed mutagenesis?
Discuss and make a list of some of the reasons why it would be informative for a geneticist to determine the amount of a gene product. Use specific examples of known genes (e.g., (I globin and other genes) when making your list.
Make a list of possible research questions that could be answered using site-directed mutagenesis.
Discuss the two principles on which evolution is based.
Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?
Discuss the major differences among allopatric, parapatric, and sympatric speciation.
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.
What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?
Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?
Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.
When comparing the coding region of protein-encoding genes among closely related species, certain regions of the gene are commonly found to have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions of the gene. Explain why different regions of a protein-encoding
Plant seeds contain storage proteins that are encoded by plant genes. When the seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polypeptides are broken), which releases amino acids for the developing seedling. Would you expect the genes
Take a look at the α-globin and β-globin sequences in Figure 28.11. Which sequences are more similar, the α globin in humans and the α globin in horses, or the α globin in humans and the (3 globin in humans? Based on your answer, would you conclude that the gene duplication that gave rise to
Compare and contrast the neutral theory of evolution versus the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution.
Evolution, which involves genetic changes in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular levels.
For each of the following examples, discuss whether it would be the result of neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of homologous genes, differences in the coding sequence are most common at the wobble base (i.e., the third
As discussed in Chapter 26, genetic variation is prevalent in natural populations. This variation is revealed in the DNA sequencing of genes. According to the neutral theory of evolution, discuss the relative importance of natural selection against detrimental mutations, natural selection in favor
If you were comparing the karyotypes of species that are closely related evolutionarily, what types of similarities and differences would you expect to find?
What is a species? What types of observations do researchers analyze when trying to identify species?
Would the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism? A. Horses and donkeys can interbreed to produce mules, but the mules are infertile. B. Three species of the orchid genus Dendrobium produce flowers 8 days, 9 days, and 11 days after a
Distinguish between anagenesis and cladogenesis. Which type of speciation is more prevalent? Why?
Describe three or more genetic mechanisms that may lead to the rapid evolution of a new species. Which of these genetic mechanisms are influenced by natural selection, and which are not?
Explain the type of speciation (allopatric, parapatric, or sympatric) most likely to occur under each of the following conditions: A. A pregnant female rat is transported by an ocean liner to a new continent. B. A meadow containing several species of grasses is exposed to a pesticide that promotes
Alloploids are produced by crosses involving two different species. Explain why alloploids may be reproductively isolated from the two original species from which they were derived. Explain why alloploids are usually sterile, whereas allotetraploids (containing a diploid set from each species) are
Two populations of snakes are separated by a river. The snakes cross the river only on rare occasions. The snakes in the two populations look very similar to each other, except that the members of the population on the eastern bank of the river have a yellow spot on the top of their head, whereas
In Chapter 22, we learned about a technique called fluorescence in situ hybridization (FISH), during which a labeled piece of DNA is hybridized to a set of chromosomes. Let's suppose that we cloned a piece of DNA from G. pubescens (see Figure 28.4) and used it as a labeled probe for in situ
A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers to the 12S rRNA mitochondrial gene, they have used PCR and obtained a DNA segment that yields a sequence homologous to crocodile DNA. Other scientists are skeptical
Discuss how the principle of parsimony can be used in a cladistics approach of constructing a phylogenetic tree.
A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The following number of nucleotide differences were obtained:Construct a phylogenetic tree that describes the evolutionary relationships among these four species using the UPGMA method. Your tree
As discussed in this chapter and Chapter 26, genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results when constructing a phylogenetic tree. How could you overcome this problem?
Sympatric speciation by allotetraploidy has been proposed as a common mechanism for speciation. Let's suppose you were interested in the origin of certain grass species in southern California. Experimentally, how would you go about determining if some of the grass species are the result of
Two diploid species of closely related frogs, which we will call species A and species B, were analyzed with regard to genes that encode an enzyme called hexokinase. Species A has two distinct copies of this gene: Al and A2. In other words, this diploid species is A1A1 A2A2. The other species has
A researcher sequenced a portion of a bacterial gene and obtained the following sequence, beginning with the start codon, which is underlined:The bacterial strain that contained this gene has been maintained in the laboratory and grown serially for many generations. Recently, another person working
F1 hybrids between two species of cotton, Gossypium barbadense and G. hirsutum, are very vigorous plants. However, F1 crosses produce many seeds that do not germinate and a high percentage of very weak F2 offspring. Suggest two reasons for these observations.
A species of antelope contains 20 chromosomes per set. The species is divided by a mountain range into two separate populations, which we will call the eastern and western population. When comparing the karyotypes of these two populations, it was discovered that the members of the eastern
Explain why molecular techniques were needed as a way to provide evidence for the neutral theory of evolution.
Prehistoric specimens often contain minute amounts of ancient DNA. What technique can be used to increase the amount of DNA in an older sample? Explain how this technique is performed and how it increases the amount of a specific region of DNA.
In the experiment of Figure 28.13, explain how we know that the kiwis are more closely related to the emu and cassowary than to the moas. Cite particular regions in the sequences that support your answer.
The raw material for evolution is random mutation. Discuss whether or not you view evolution as a random process.
Compare the forms of speciation that are slow with those that occur more rapidly. Make a list of the slow and fast forms. With regard to mechanisms of genetic change, what features do slow and rapid speciation have in common? What features are different?
Do you think that Darwin would object to the neutral theory of evolution?
Describe the anticodon of a single tRNA that could recognize the codons 5'-AAC-3' and 5'-AAU-3'. How would this tRNA need to be modified for it to also recognize 5'-AAA-3'?
Describe the structural features that all tRNA molecules have in common.
What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the "second genetic code." Why has the function of this type of enzyme been described this way?
What is an activated amino acid?
Discuss the significance of modified bases within tRNA molecules.
Is it necessary for a cell to make 61 different tRNA molecules, corresponding to the 61 codons for amino acids? Explain your answer.
List the components required for translation. Describe the relative sizes of these different components. In other words, which components are small molecules, macromolecules, or assemblies of macromolecules?
What does it mean when we say that the genetic code is degenerate? Discuss the universality of the genetic code.
Showing 2700 - 2800
of 4619
First
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
Last
Step by Step Answers
Get 50% OFF
Claim Now
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)
.png)
-1.png){kind=small}
-2.png){kind=small}
