New Semester Started Get 50% OFF Study Help! --h --m --s Claim Now

Question Answers

Textbooks

Find textbooks, questions and answers

Oops, something went wrong!

Change your search query and then try again

Result Not Found

Books FREE
Study Help
Tutors
AI Study Planner NEW
Sell Books

Search
Sign In
Register

study help
medical sciences
biology

Genetics Analysis And Principles 5th Edition Robert Brooker - Solutions

In Noll's experiment of Figure 10.12, explain where the DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations?
When chromatin is treated with a moderate salt concentration, the linker histone HI is removed (see Figure 10.13a). Higher salt concentration removes the rest of the histone proteins (see Figure 10.19b). If the experiment of Figure 10.12 were carried out after the DNA was treated with moderate or
If you were given a sample of chromosomal DNA and asked to determine if it is bacterial or eukaryotic, what experiment would you perform, and what would be your expected results?
Consider how histone proteins bind to DNA and then explain why a high salt concentration can remove histones from DNA (as shown in Figure 10.19b).
In Chapter 22, the technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that
Bacterial and eukaryotic chromosomes are very compact. Discuss the advantages and disadvantages of having a compact structure.
The prevalence of highly repetitive sequences seems rather strange to many geneticists. Do they seem strange to you? Why or why not? Discuss whether or not you think they have an important function.
Discuss and make a list of the similarities and differences between bacterial and eukaryotic chromosomes.
As shown in Figure 11.5, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the
Obtain two strings of different colors (e.g., black and white) that are the same length. A length of 20 inches is sufficient. Tie a knot at one end of the black string, and tie a knot at one end of the white string. Each knot designates the 5' end of your strings. Make a double helix with your two
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. With regard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrect pyrimidine instead of the correct pyrimidine (e.g., adding cytosine where thymine
A short genetic sequence, which may be recognized by primase, is repeated many times throughout the E. coli chromosome. Researchers have hypothesized that primase may recognize this sequence as a site to begin the synthesis of an RNA primer for DNA replication. The E. coli chromosome is roughly 4.6
The ability of DNA polymerase to digest a DNA strand from one end is called its exonuclease activity. Exonuclease activity is used to digest RNA primers and also to proofread a newly made DNA strand. DNA polymerase I does not change direction while it is removing an RNA primer and synthesizing new
In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragments. The RNA primers have not yet been removed.The top strand is the template DNA.A. Which Okazaki
Describe the three important functions of DnaA protein.
What is an Okazaki fragment? In which strand of DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?
Discuss the similarities and differences in the synthesis of DNA in the lagging and leading strands. What is the advantage of a primosome and a replisome as opposed to having all replication enzymes functioning independently of each other?
Explain the proofreading function of DNA polymerase.
What is a processive enzyme? Explain why this is an important feature of DNA polymerase.
What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA
A diagram of a linear chromosome is shown here. The end of each strand is labeled with an A, B, C, or D. Which ends could not be replicated by DNA polymerase? Why not?
As discussed in Chapter 17, some viruses contain RNA as their genetic material. Certain RNA viruses can exist as a provirus in which the viral genetic material has been inserted into the chromosomal DNA of the host cell. For this to happen, the viral RNA must be copied into a strand of DNA. An
Telomeres contain a 3' overhang region, as shown in Figure 11.21. Does telomerase require a 3' overhang to replicate the telomere region? Explain.
The compound known as nitrous acid is a reactive chemical that replaces amino groups (-NH2) with keto groups (=O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following
One way that bacterial cells regulate DNA replication is by GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semi-conservatively) replicated?
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming DNA polymerase III is the primary enzyme involved and this enzyme can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a
Here are two strands of DNA. ---------------------DNA polymerase → ------------------------------------------- The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5' and 3' ends of the top and
A DNA strand has the following sequence: 5'-GATCCCGATCCGCATACATTTACCAGATCACCACC-3' In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made
List and briefly describe the three types of sequences within bacterial origins of replication that are functionally important.
Answer the following questions that pertain to the experiment of Figure 11.3. A. What would be the expected results if the Meselson and Stahl experiment were carried out for four or five generations? B. What would be the expected results of the Meselson and Stahl experiment after three generations
An absentminded researcher follows the steps of Figure 11.3, and when the gradient is viewed under UV light, the researcher does not see any bands at all. Which of the following mistakes could account for this observation? Explain how. A. The researcher forgot to add 14N-containing compounds. B.
Figure 11.4b shows an autoradiograph of a replicating bacterial chromosome. If you analyzed many replicating chromosomes, what types of information could you learn about the mechanism of DNA replication?
As described in Table 11.3, what is the difference between a rapid-stop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants?
The technique of dideoxy sequencing of DNA is described in Chapter 20. The technique relies on the use of dideoxyribonucleotides (shown in Figures 20.11 and 20.12). A dideoxyribonucleotide has a hydrogen atom attached to the 3'-carbon atom instead of an -OH group. When a dideoxyribonucleotide is
Another technique described in Chapter 20 is polymerase chain reaction (PCR) (see Figures 20.5 and 20.6). This method is based on our understanding of DNA replication. In this method, a small amount of double-stranded template DNA is mixed with a high concentration of primers. Nucleotides and DNA
Compare and contrast DNA replication in bacteria and eukaryotes.
DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of these three features you think is the most important.
Genes may be protein-encoding genes that encode polypeptides, or they may not. A. Describe three examples of genes that are not protein-encoding genes. B. For protein-encoding genes, one DNA strand is called the template strand, and the complementary strand is called the coding strand. Are these
At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.
Let's suppose a DNA mutation changes the consensus sequence at the -35 location in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Look at Figure 12.5 and describe two specific base substitutions you think would inhibit the binding of
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5'-GGCAUGCAUUACGGCAUCACACUAGGGAUC-3' What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5' or 3')
Describe the movement of the open complex along the DNA.
Discuss the differences between ρ-dependent and ρ-independent termination.
In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.
Discuss the similarities and differences between RNA polymerase (described in this chapter) and DNA polymerase (described in Chapter 11).
Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent p-independent termination? B. What types of mutations would prevent p-dependent termination? C. If a mutation prevented transcriptional
If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III
What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes? Describe their locations and specific functions.
For each of the following transcription factors, how would eukaryotic transcriptional initiation be affected if it were missing? A. TFIIB B. TFIID C. TFIIH
Describe the allosteric and torpedo models for transcriptional termination of RNA polymerase II. Which model is more similar to ρ-dependent termination in bacteria and which model is more similar to ρ-independent termination?
Which eukaryotic transcription factor(s) shown in Figure 12.14 play(s) an equivalent role to σ factor found in bacterial cells?
The initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions-hydrogen bonding, ionic bonding, covalent bonding, and/or hydrophobic interactions-would you expect to drive the assembly and disassembly
Describe the processing events that occur during the production of tRNA in E. coli.
Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain snRNA. In other words, what do you think is/are the functional role(s) of snRNA during splicing?
What is the unique feature of ribozyme function? Give two examples described in this chapter.
What does it mean to say that gene expression is colinear?
What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?
What is meant by the term self-splicing? What types of introns are self-splicing?
What is alternative splicing? What is its biological significance?
The processing of ribosomal RNA in eukaryotes is shown in Figure 12.16. Why is this called cleavage or processing but not splicing?
In the splicing of group I introns shown in Figure 12.20, does the 5' end of the intron have a phosphate group? Explain.
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase transcription are termed up-promoter mutations, and those that decrease transcription are termed down-promoter mutations. As shown in Figure 12.5, the sequence of the -10
According to the examples shown in Figure 12.5, which positions of the -35 sequence (i.e., first, second, third, fourth, fifth, or sixth) are more tolerant of changes? Do you think these positions play a more or less important role in the binding of o factor? Explain why.
In Chapter 9, we considered the dimensions of the double helix (see Figure 9.15). In an α helix of a protein, there are 3.6 amino acids per complete turn. Each amino acid advances the α helix by 0.15 nm; a complete turn of an α helix is 0.54 nm in length. As shown in Figure 12.6, two α helices
What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional roles of the different subunits?
A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5'-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC
What is an R loop? In an R loop experiment, to which strand of DNA does the mRNA bind, the coding strand or the template strand?
If a gene contains three introns, draw what it would look like in an R loop experiment.
Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of cloned DNA as a probe. The DNA probe, which is labeled, is complementary to the RNA that the researcher
A gel retardation assay can be used to study the binding of proteins to a segment of DNA. This method is described in Chapter 20. When a protein binds to a segment of DNA, it retards the movement of the DNA through a gel, so the DNA appears at a higher point in the gel (see the following).Lane 1:
As described in Chapter 20 and in experimental question E5, a gel retardation assay can be used to determine if a protein binds to DNA. This method can also determine if a protein binds to RNA. In the combinations described here, would you expect the migration of the RNA to be retarded due to the
The technique of DNA footprinting is described in Chapter 20. If a protein binds over a region of DNA, it will protect the DNA in that region from digestion by DNase I. To carry out a DNA foot-printing experiment, a researcher has a sample of a cloned DNA fragment. The fragments are exposed to
As described in Table 12.1, several different types of RNA are made, especially in eukaryotic cells. Researchers are sometimes interested in focusing their attention on the transcription of protein-encoding genes in eukaryotes. Such researchers want to study mRNA. One method that is used to isolate
Based on your knowledge of introns and pre-mRNA splicing, discuss whether or not you think alternative splicing fully explains the existence of introns. Can you think of other possible reasons to explain the existence of introns?
Discuss the types of RNA transcripts and the functional roles they play. Why do you think some RNAs form complexes with protein subunits?
What is a recombinant microorganism? Discuss examples.
As described in Chapter 5, not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial genes are notable exceptions. With these ideas in mind, let's
Discuss the concerns that some people have with regard to the uses of genetically engineered organisms.
A conjugation-deficient strain of A. radiobacter is used to combat crown gall disease. Explain how this bacterium prevents the disease and the advantage of a conjugation deficient strain.
What is bioremediation? What is the difference between biotransformation and biodegradation?
What is a biological control agent? Briefly describe two examples.
As described in Table 21.2, several medical agents are now commercially produced by genetically engineered microorganisms. Discuss the advantages and disadvantages of making these agents this way.
What is a mouse model for human disease?
What is a transgenic organism? Describe three examples.
Explain the difference between gene addition and gene replacement. Are the following descriptions examples of gene addition or gene replacement? A. A mouse model to study cystic fibrosis B. Introduction of a pesticide-resistance gene into corn using the T-DNA vector of A. tumefaciens
Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how this is accomplished.
What is a chimera? How are chimeras made?
Evidence suggests that Dolly may have been "genetically older" than her actual age would have suggested. As mammals age, the chromosomes in somatic cells tend to shorten from the telomeres. Therefore, older individuals have shorter chromosomes in their somatic cells than do younger ones. When
When transgenic organisms are made, the transgene may integrate into multiple sites within the genome. Furthermore, the integration site may influence the expression of the gene. For example, if a transgene integrates into a heterochromatic (i.e., highly condensed) region of a chromosome, the
What is molecular pharming? Compared with the production of proteins by bacteria, why might it be advantageous?
What is reproductive cloning? Are identical twins in humans considered to be clones? With regard to agricultural species, what are some potential advantages to reproductive cloning?
Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental impairment. This disorder is inherited in an autosomal recessive manner, and the mutant allele is known to be a loss-of-function mutation. The same gene has been found in mice, although a mutant
Treatment of adenosine deaminase (ADA) deficiency is an example of ex vivo gene therapy. Why is this therapy called ex vivo? Can ex vivo gene therapy be used to treat all inherited diseases? Explain.
Several research studies are under way that involve the use of gene therapies to inhibit the growth of cancer cells. As discussed in Chapter 24, oncogenes are mutant genes that are overexpressed and cause cancer. New gene therapies are aimed at silencing an oncogene by producing antisense RNA that
Bacillus thuringiensis makes toxins that kill insects. This toxin must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one strategy is to apply bacteria directly to leaves. However, B. thuringiensis does not survive very long
In the experiment of Figure 21.1, why was it necessary to link the coding sequence for the A or B chains to the sequence for β-galactosidase? How were the A or B chains separated from β-galactosidase after the fusion protein was synthesized in E. coli?
Explain how it is possible to select for homologous recombination in mice. What phenotypic marker is used to readily identify chimeric mice?
To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens and then grown in media containing kanamycin, carbenicillin, and plant growth hormones. Explain the purpose behind each of these three agents. What would happen if you left out the kanamycin?
List and briefly describe five methods for the introduction of cloned genes into plants.
What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?

Showing 2400 - 2500 of 4619

First
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
Last

Step by Step Answers

Services

Sitemap
Fun
Definitions
Become Tutor
Used Textbooks
Study Help Categories
Recent Questions
Expert Questions
Campus Wear
Sell Your Books

Company Info

Security
Copyrights
Privacy Policy
Terms & Conditions
SolutionInn Fee
Scholarship
Online Quiz
Give Feedback, Get Rewards

Get In Touch

About Us
Contact Us
Career
Jobs
FAQ
Student Discount
Campus Ambassador

Secure Payment

Download Our App

© 2026 SolutionInn. All Rights Reserved