New Semester
Started
Get
50% OFF
Study Help!
--h --m --s
Claim Now
Question Answers
Textbooks
Find textbooks, questions and answers
Oops, something went wrong!
Change your search query and then try again
S
Books
FREE
Study Help
Expert Questions
Accounting
General Management
Mathematics
Finance
Organizational Behaviour
Law
Physics
Operating System
Management Leadership
Sociology
Programming
Marketing
Database
Computer Network
Economics
Textbooks Solutions
Accounting
Managerial Accounting
Management Leadership
Cost Accounting
Statistics
Business Law
Corporate Finance
Finance
Economics
Auditing
Tutors
Online Tutors
Find a Tutor
Hire a Tutor
Become a Tutor
AI Tutor
AI Study Planner
NEW
Sell Books
Search
Search
Sign In
Register
study help
life sciences
molecular cell biology
Molecular Cell Biology 7th edition Harvey Lodish, Arnold Berk, Chris A. Kaiser, Monty Krieger, Anthony Bretscher, Hidde Ploegh, Angelika Amon, Matthew P. Scott - Solutions
Upon identification of the DNA regulatory sequence responsible for translating a given gene, you note that it is enriched with CG sequences. Is the corresponding gene likely to be a highly expressed transcript?
Some organisms have mechanisms in place that will override transcription termination. One such mechanism using the Tat protein is employed by the HIV retrovirus. Explain why Tat is therefore a good target for HIV vaccination.
You are curious to identify the region of.gene X sequence that serves as an enhancer for gene expression. Design an experiment to investigate this issue.
Compare/contrast bacterial and eukaryotic gene expression mechanisms.
Recall that the Trp repressor binds to a site in the operator region of tryptophan-producing genes when tryptophan is abundant, thereby preventing transcription. What would happen to the expression of the tryptophan biosynthetic enzyme genes in the following scenarios? Fill in the blanks with one
Prokaryotcs and lower eukaryotes such as yeast have DNA-regulatory elements called upstream activating sequences. What arc the comparable sequences found in higher eukaryotic species?
The yeast two-hybrid method is a powerful molecular genetic method to identify a protcin(s) that interacts with a known protein or protein domain. You have isolated the glucocorticoid receptor (GR) and have evidence that it is a modular protein containing an activation domain, a DNA binding domain,
You have isolated a new protein called STICKY. You can predict from comparisons with other known proteins that STICKY contains a bHLH domain and a Sin3-interacting domain. Predict the function of STICKY and rationale for the importance of these domains in STICKY function.
Using CREB and nuclear receptors as examples, compare and contrast the structural changes that take place when these transcription factors bind to their co-activators.
Give two examples of how gene expression may be repressed without altering the gene-coding sequence.
Describe the structural features of transcriptional activator and repressor proteins.
Describe the methods used to identify the location of DNA-binding proteins in the regulatory regions of genes.
What is the difference between a promoter-proximal element and a distal enhancer? What are the similarities?
Describe the methods used to identify the location of DNA control elements in promoter proximal regions of genes.
What do TATA boxes, initiators, and CpG islands have in common? Which was the first of these to be identified? Why?
The CTD of the largest subunit of RNA polymerase II can be phosphorylated at multiple serine residues. What are the conditions that lead to the phosphorylated versus unphosphorylated RNA polymerase II CTD?
What types of genes are transcribed by RNA polymcrases I, II, and III? Design an experiment to determine whether a specific gene is transcribed by RNA polymerase II.
The concentration of free glutamine affects transcription of the enzyme glutamine synthetase in E. coli. Describe the mechanism for this.
Describe the molecular events that occur at the lac operon when E. coli cells are shifted from a glucose-containing medium to a lactose-containing medium.
Satellite DNA is a known component of our genome and can be found in both coding and noncoding DNA. When it is found in coding DNA, the number of repeats can result in altered proteins. Bur the effect of these repeats in noncoding DNA is nor as well understood. To determine whether repeats in the
To determine whether gene transfer from an organelle genome to the nucleus can be observed in the laboratory, a chloroplast transformation vector was constructed that contained two selectable antibiotic-resistance markers, each with its own promoter: the spectinomycin-resistance gene and the
Describe the problem that occurs during DNA replication at the ends of chromosomes. How are telomeres related to this problem?
Replication and segregation of eukaryotic chromosomes require three functional elements: replication origins, a centromere, and telomeres. How would a chromosome be affected if it lacked (a) Replication origins (b) A centromere?
Certain organisms contain cells that possess polytene chromosomes. What are polytene chromosomes, where are they found, and what function do they serve?
What is chromosome painting, and how is this technique useful? How can chromosome paint probes be used to analyze the evolution of mammalian chromosomes?
What is FISH? Briefly describe how it works. How is FISH used to characterize chromosomal translocations associated with certain genetic disorders and specific types of cancers?
Describe the general organization of a eukaryotic chromosome. What structural role do scaffold-associated regions (SARs) or matrix attachment regions (MARs) play? Why does it make sense that protein-coding genes are not located in these regions?
How do chromatin modifications regulate transcription? What modifications are observed in regions of the genome that are actively being transcribed? What about for regions that are not actively transcribed?
The DNA in a cell associates with proteins to form chromatin. What is a nucleosome? What role do histones play in nucleosomes? How are nucleosomes arranged in condensed 30-nm fibers?
What are paralogous and orthologous genes? What are some of the explanations for the finding that humans are a much more complex organism than the roundworm C. elegans, yet have only fewer than one and a half as many genes (25,000 versus 18,000)?
Mitochondria and chloroplasts are thought to have evolved from symbiotic bacteria present in nucleated cells. What is the experimental evidence from this chapter that supports this hypothesis?
Discuss the role that transposons may have played in the evolution of modern organisms. What is exon shuffling? What role do transposons play in the process of exon shuffling?
Retrotransposons are a class of mobile elements that transpose via an RNA intermediate. Contrast the mechanism of transposition between rctrotransposons that contain long terminal repeats (LTRs) and those that lack LTRs.
Mobile DNA elements that can move or transpose to a new site directly as DNA are called DNA transposons. Describe the mechanism by which a bacterial DNA transposon, called an insertion sequence, can transpose.
Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite and minisatellite DNA. How is this repetitious DNA useful for identifying individuals by the technique of DNA fingerprinting?
Sequencing of the human genome has revealed much about the organization of genes. Describe the differences between solitary genes, gene families, pseudogenes, and tandemly repeated genes.
Genes can be transcribed into mRNA for protein-coding genes or into RNA for genes such as ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) Continuous, (b) Simple, or (c) Complex transcription units.(i) Found in
A culture of yeast that requires uracil for growth (urα3ÍË was mutagenized, and two mutant colonies, X and Y, have been isolated. Mating type a cells of mutant X arc mated with mating type a cells of mutant Y to form diploid cells. The parental
Two methods for functionally inactivating a gene without altering the gene sequence are by dominant-negative mutations and RNA interference (RNAi). Describe how each method can inhibit expression of a gene?
The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout
Genetic linkage studies can usually only roughly locate the chromosomal position of a "disease" gene. How can expression analysis and DNA sequence analysis help locate a disease gene within the region identified by linkage mapping?
How can linkage-disequilibrium mapping sometimes provide a much higher resolution of gene location than classical linkage mapping?
DNA polymorphisms can be used as DNA markers. Describe the d1fferences between SNP and SSR polymorphisms. How can these markers be used for DNA-mapping studies?
In determining the identity of the protein that corresponds to a newly discovered gene, it often helps to know the pattern of tissue expression for that gene. For example, researchers have found that a gene called SERPINA6 is expressed in the liver, kidney, and pancreas but not in other tissues.
Northern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies yeast cells, Comparing their growth in two different sugars, glucose and galactose. One student is comparing expression of the gene HMG2 under the different conditions. Which technique(s) could he use
A number of foreign proteins have been expressed in bacterial and mammalian cells. Describe the essential features of a recombinant plasmid that are required for expression of a foreign gene. How can you modify the foreign protein to facilitate its purification? What is the advantage of expressing
Southern and Northern blotting are powerful tools in molecular biology based on hybridization of nucleic acids. How are these techniques the same? How do they differ? Give some specific applications for each blotting technique.
In 1993, Ka'ry Mullis won the Nobel Prize in Chemistry for his invention of the PCR process. Describe the three steps in each cycle of a PCR reaction. Why was the discovery of a thermostable DNA polymerase (e.g., Taq polymerase) so important for the development of PCR?
A DNA library is a collection of clones, each containing a different fragment of DNA, inserted into a cloning vector. What is the difference between a eDNA and a genomic DNA library? You would like to clone gene X, a gene expressed only in neurons, into a vector using a library as the source of
Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector. What are the advantages and applications of plasmids as cloning vectors?
Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of restriction-enzyme sites. What are the three types of DNA ends that can be generated after cutting DNA
Jane has isolated a mutant strain of yeast that forms red colonies instead of the normal white when grown on a plate. To determine the mutant gene, she decides to use functional complementation with a DNA library containing a lysine selection marker. lu addition to the unknown gene mutation, the
Describe how complementation analysis can be used to reveal whether two mutations are in the same or in different genes. Explain why complementation analysis will not work with dominant mutations?
What is a temperature-sensitive mutation? Why are temperature-sensitive mutations useful for uncovering the function of a gene?
Genetic mutations can provide insights into the mechanisms of complex cellular or developmental processes. How might your analysis of a genetic mutation be different depending on whether a particular mutation is recessive or dominant?
Protein synthesis in eukaryotes normally begins at the first AUG codon in the mRNA. Sometimes, however, the ribo-somes do not begin protein synthesis at this first AUG but scan past it (leaky scanning), and protein synthesis begins instead at an internal AUG. In order to understand what features of
a. Detail the key differences between lytic and nonlytic viral infection and provide an example of each.b. Which of the following processes occurs in both lytic and nonlytic viral infections?(i) Infected cell ruptures to release viral particles.(ii) Viral mRNAs are transcribed by the host-cell
Identify the specific types of point mutations below (you are viewing the direct DNA version of the RNA sequence).Original sequence: 5' AUG TCA GGA CGT CAC TCA GCT 3'Mutation A: 5' AUG TCA GGA CGT CAC TGA GCT 3'Mutation B: 5' AUA TCA GGA CGT CAC TCA GCT 3'
The DNA repair systems preferentially target the newly synthesized strand. Why is this important?
a. Look at the figure below. Explain why it is necessary for Okazaki fragments to be formed as the lagging strand is produced (instead of a continuous strand).b. If the DNA polymerase in the figure above could only bind to the lower template strand, under what conditions(s) would it be able to
Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. lntron sequences are highlighted. Note: Not all amino acids in the key will be
You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that will be adversely affected in the following scenarios.a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA.b. The mRNA
Contrast prokaryotic and eukaryotic gene characteristics.
a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction?5' ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3' 3 'TGCCTGACATGGCGACTTCAGT ACCTGCGAGCT 5'→Direction of DNA unwindingb. What would be
The genome of a retrovirus can integrate into the host-cell genome. What gene is unique to retroviruses, and why is the protein encoded by this gene absolutely necessary for maintaining the retroviral life cycle? A number of retroviruses can infect certain human cells. List two of them, briefly
What is the name given to the process that can repair DNA damage and generate genetic diversity? Briefly describe the similarities and differences of the two processes.
DNA-repair systems are responsible for maintaining genomic fidelity in normal cells despite the high frequency with which mutational events occur. What type of DNA mutation is generated by (a) UV irradiation (b) Ionizing radiation? Describe the system responsible for repairing each
Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimmers that form as a result of UV light damage to DNA?
What characteristic of DNA results in the requirement that some DNA synthesis is discontinuous? How are Okazaki fragments and DNA ligase utilized by the cell?
How would a mutation in the poly (A)-binding protein gene affect translation? How would an electron micrograph of polyribosomes from such a mutant differ from the normal pattern?
The transcription of many bacterial genes relies on functional groups called operons, such as the tryptophan operon. What is an operon? What advantages are there to having genes arranged in an operon, compared with the arrangement in eubaryotes?
While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a membrane-spanning domain functions to recognize growth factors at the cell surface, stimulating a
What are the major differences in the synthesis and structure of prokaryotic and eukaryotic mRNAs?
What difference between RNA and DNA helps to explain the greater stability of DNA? What implications does this have for the function of DNA?
Preparing plasmid (double-stranded, circular) DNA for sequencing involves annealing a complementary, short, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90oC and then slowly bringing the
What are Watson-Crick base pairs? Why are they important?
Proteomics involves the global analysis of protein expression. In one approach, all the proteins in control cells and treated cells are extracted and subsequently separated using two-dimensional gel electrophoresis. Typically, hundreds or thousands of protein spots are resolved and the steady-state
Mass spectrometry is a powerful tool in proteomics. What are the four key features of a mass spectrometer? Describe briefly how MALDI and two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) could be used to identify a protein expressed in cancer cells but nor in normal healthy cells.
Physical methods are often used to determine protein conformation. Describe how x-ray crystallography, cryoelectron microscopy, and NMR spectroscopy can be used to determine the shape of proteins. What are the advantages and disadvantages of each method? Which is better for small proteins? Large
Various methods have been developed for detecting proteins. Describe how radioisotopes and autoradiography can be used for labeling and detecting proteins. How does Western blotting detect proteins?
Chromatography is an analytical method used to separate proteins. Describe the principles for separating proteins by gel filtration, ion-exchange, and affinity chromatography.
A number of techniques can separate proteins on the basis of their differences in mass. Describe the use of two of these techniques, centrifugation and gel electrophoresis. The blood proteins transferrin (MW 76 kDa) and lysozyme (MW 15 kDa) can be separated by rate-zonal centrifugation or
The function of proteins can be regulated in a number of ways. What is cooperativity, and how does it influence protein function? Describe how protein phosphorylation and proteolytic cleavage can modulate protein function.
Proteins are degraded in cells. What is ubiquitin, and what role does it play in tagging proteins for degradation? What is the role of proteasomes in protein degradation? How might proreasome inhibitors serve as chemotherapeutic (cancer-treating) agents?
A healthy adaptive immune system can raise antibodies that recognize and bind with high affinity to almost any stable molecule. The molecule to which an antibody binds is known as "antigen." Antibodies have been exploited by enterprising scientists to generate valuable tools for research,
The following reaction coordinate diagram charts the energy of a substrate molecule (S) as it passes through a transition state (Xt) on its way to becoming a stable product (P) alone or in the presence of one of two different enzymes (El and E2). How does the addition of either enzyme affect the
Enzymes catalyze chemical reactions. What constitutes the active sire of an enzyme? What are the turnover number (kcat), the Michaelis constant (K111), and the maximal velocity ( Vmax,) of an enzyme? The kcat for carbonic anhydrase is 5 X 105molecules/s. This is a "rate constant" bur nor a "rate."
Proper folding of proteins is essential for their biological activity. In genetal, the functional conformation of a protein is the conformation with lowest energy. This means that if an unfolded protein is allowed to reach equilibrium, it should assemble automatically into its native, functioning
The three-dimensional structure of a protein is determined by its primary, secondary, and tertiary structures. Define the primary, secondary, and tertiary structures. What are some of the common secondary structures? What are the forces that hold together the secondary and tertiary structures?
The graph below illustrates the effect that the addition of a strong base such as sodium hydroxide has on the pH of an aqueous 0.1 M solution of an amino acid. Assume that prior to the addition of any OH-, the entire dissolved amino acidSample is in its fully protonated form. The addition of OH-
During much of the "Age of Enlightenment" in eighteenth- century Europe, scientists toiled under the belief that living things and the inanimate world were fundamentally distinct forms of matter. Then in 1828, Friedrich Wohler showed that he could synthesize urea, a well-known waste product of
According to health experts, saturated fatty acids, which come from animal fats, are a major factor contributing to coronary heart disease. What distinguishes a saturated fatty acid from an unsaturated fatty acid, and to what does the term saturated refer? Recently, trans unsaturated fatty acids,
The ΔG0' for the reaction X + Y → XY is -1000 cal/mol. What is the ΔG at 25oC (298 Kelvin) starting with 0.01 M each X, Y, and XY? Suggest two ways one could make this reaction energetically favorable.
What is the ionization state of phosphoric acid in the cytoplasm? Why is phosphoric acid such a physiologically important compound?
Consider the binding reaction L + R → LR, where L is a ligand and R is its receptor. When 1 X 10-3 M L is added to a solution containing 5 X 10-2 M R, 90 percent of the L binds to form LR. What is the K cq of this reaction? How will the Keq be affected by the addition of a protein that
Ammonia (NH3) is a weak base that under acidic conditions becomes protonated to the ammonium ion in the following reaction:NH3 + H+ → NH4+NH3 freely permeates biological membranes, including those of lysosomes. The lysosome is a sub-cellular organelle with a pH of about 4.5-5.0; the pH of
Calculate the pH of 1 L of pure water at equilibrium. How will the pH change after 0.008 moles of the strong base NaOH are dissolved in the water? Now, calculate the pH of a 50 mM aqueous solution of the weak acid 3-(N-morpholino) propane- 1-sulfonic acid (MOPS) in which 61% of the solute is in its
The chemical basis of blood-group specificity resides in the carbohydrates displayed on the surface of red blood cells. Carbohydrates have the potential for great structural diversity. Indeed, the structural complexity of the oligosaccharides that can be formed from four sugars is greater than that
Name the compound shown below.Is this nucleotide a component of DNA, RNA, or both? Name one other function of this compound. IN HN, E 8CH 9, N. 'N. Н,N 5" -0-P-0-0-P-0-0-P-0 — сн, Н Н Н Н 2" Он ОН ч
In the 1960s, the drug thalidomide was prescribed to pregnant women to treat morning sickness. However, thalidomide caused severe limb defects in the children of some women who took the drug, and its use for morning sickness was discontinued. It is now known that thalidomide was administered as a
Showing 400 - 500
of 710
1
2
3
4
5
6
7
8
Step by Step Answers