Algorithms Questions and Answers May 25, 2018

Write the pytorch code to implement the overall architecture of the decoder part of a transformer from input to output. I basically need you to explain the overall code in the bigram model class.

Write a load Buildings function. It accepts the file name as input and returns a dictionary of building codes as the keys and building names as the values. Q5.2 1 Point Write a getkeys function. It accepts a dictionary as input and returns a string of commaseparated keys in alphabetical order. Q5.3 1 Point Write a getBuilding function that accepts

Write program in python that involves hashing , built upon markov chain logarithm The program will be altered to use a hash table ADT rather than a Python built in dictionaries The input will include the table size for the hash table, as specified under Input Format . Some error checking is required as specified under Errors . General

Running a program that ends in a yes/no response. I need the "yes" response to trigger the program to ask the same questions as when the program started.... Example: def multiply (a,b): return a*b a = float(input("What is the price of each tablet?")) b = float(input("How many tablets are you purchasing?")) SalesTax = .10 Shipping = 15 Subtotal =

Rearrange the following lines so that the code properly reads a sequence of integers and computes and prints their sum, using 1 as a sentinel. Not all lines are useful. Empty print statements are included for output formatting. How to use this tool Unused while value 8 while value 1 value int(input (Enter a value or 1 to finish )) print()

Using a matrix to help you, write the polynomial 2271 as a linear combination over R of the polynomials 2x2, 2xx8 and x 2z4. (12 points) (a) Do the vectors 2 and span R4 Explain your answer. Describe all solutions to the system of equations x2z3w5 yw4 x 2y 2z5w 13 2x 2y 4z 4w 2 Consider the system of equations x2y3z 5 315

Lily drove a total of 500 miles on g gallons of gas. Express her fuel economy measurement in miles per gallon as an algebraic expression. Do

1.A pendulum control system is shown below. Suppose the desired angle is r and actual angle is y. Disturbance torque is d. Controller is represented by a gain of 5, motor is represented by a gain of 2, and pendulum system is represented by a gain of 10, optical encoder is represented by a gain of 1. (a). Find the expression of y in terms of r and

2. Write a Python function in a Google Colab notebook that translates the given RNA sequence, AUGGGCGGAUACCCCUUAUUG, to its corresponding amino acid sequence based on the codon chart below. Describe what each line of your function does. You can submit either a link to the notebook, or download and attach it to this assignment. First letter A G U

Using HTML Static Content, CSS a. Display the products available to purchase along with a button to add the product to the order. b. Minimum 5 products should be available for purchase. c. Use textbox. Number box should not be used. d. The design is of your choice.

In a large APMA 1650 class, much larger than our own, students are assigned to study groups. You are now a TA for the class and you must decide a reasonable study group configuration. (a) You test a method where students are placed in groups of 4. The last 16 students left to be paired are 8 firstyears and 8 secondyears. If groups of 4 are chosen

Welcome back to the DMV The DMV has altered their system for assigning customers to service counters. Now, when a customer enters the DMV, they press a button that randomly selects one of three letter generators. The selected letter generator then assigns one of six service counters to the customer, which are labelled A, B, C, D, E, and F. While

First, make a directory temp inside your personal directory. Then, position yourself in directory temp. Use relative pathnames to copy into temp all of the files in homeOMIS107HW2 whose name ends with 120, 121, 122, ..., up to 180 included. (one or two cp commands) Print the lines of alice.txt where the word Alice appears shortly before an

You are provided with two implementations of a 4bit signandmagnitude adder (1) a SystemVerilog module found in signmagadd.svand (2) a corresponding ROM table found in truthtable4.txt. These operations can be tricky to interpret at first because youre so used to Twos Complement arithmetic. First interpret both inputs values in signandmagnitude, add

UniProt database (httpswww.uniprot.org) is where you can find the sequence of a specific gene. Please use the UniProt database to find the amino acid sequence of the gene KMT2AHUMAN and the gene KMT2AMOUSE. Write down the first 50 amino acids of KMT2AHUMAN (5 points) and the first 50 amino acids of KMT2AMOUSE (5 points) here.

MindBook decides to diversify their portfolio and invest in the RoboMap technology which is a robot that maps different types of territories. The new CEO is trying to make some drastic changes to some of the software and hardware systems in the new version of the robot. You have been hired by the opposing faction in the board to lead an

2. Practice with asymptotics (bigOh, bigOmega, bigTheta). Let f(n) and g(n) be positive functions. Recall that f(n) O(g(n)) if there exist constants c, no 0 such that f(n) c g(n) for all n no. 2 EECS 376 Foundations of Computer Science University of Michigan, Winter 2024 Homework 1 Due 800pm, January 17 (accepted until 959 pm, no credit after)

Which of these describe an INDEXED FILE ORGANIZATION (There can be more than one answer) mark all correct answers a. Referencing storage space, this method has no wasted space. b. Referencing sequential retrieval on the primary key, this method is impractical. c. Referencing multiple key retrieval, this method is not possible. d. Referencing

3. Determine if the following expressions are logically equivalent. You must provide support for your answer. (pq) r, (pr) (qr).

1. Explain what SQL injections are and what they can do. (5 marks) 2. Find a video on YouTube (and provide the link) or other referenced material, and learn how to attack an unprotected site with SQL injections you may provide this link to other class members if you choose. How can you tell easily if a site is unprotected Provide examples of the

The relation state specifying that nonprimary key attributes do not depend on other nonprimary key attributes is a. first normal form. b. second normal form. c. BoyceCodd normal form. d. third normal form. e. fifth normal form. Value 1 The process of splitting or combining normalized relations into physical tables based on affinity of use of rows

Use the following business rules to draw the fully labeled Crows Foot ERD in Visio. The diagram must include all entities, attributes, and relationships. Primary keys and foreign keys must be clearly identified on the diagram. Write all appropriate connectivities and cardinalities on the ERD. a). A company employs many employees. b). Each employee

M2 Lab Exercise 5 Offset (d) 00 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 0000000000 33 CO 8E DO BC 00 7C 8E CO SE D8 BE 00 7C BF 00 0000000016 06 B9 00 02 FC F3 A4 50 68 1C 06 CB FB B9 04 00 0000000032 BD BE 07 80 7E 00 00 7C OB OF 85 OE 01 83 C5 10 0000000048 E2 F1 CD 18 88 56 00 55 C6 46 11 05 C6 46 10 00 0000000064 B4 41 BB AA 55 CD 13 5D

M2 Lab Exercise 6 0000001024 16 E3 C9 E3 5C OB B8 4D 81 7D F9 2D FO 02 15 AE 0000001040 B6 B6 61 5A 30 7F BF 4D 8A CE 99 5F E7 F6 C9 27 0000001056 22 00 00 00 00 00 00 00 21 00 01 00 00 00 00 00 0000001072 00 00 00 00 00 00 00 00 4D 00 69 00 63 00 72 00 0000001088 6F 00 73 00 6F 00 66 00 74 00 20 00 72 00 65 00 0000001104 73 00 65 00 72 00 76 00

Task 1. Find the recursive formula for the sequence 2, 3, 6, 18, 108, 1944, ... Then define a recursive function named mysterySequence that returns the nth member of the sequence. For example, the output for mysterySequence (4) is 108. Task 2. Spherical objects, such as tennis balls, can be stacked to form a pyramid with one tennis ball at the

The Process Node (Oturprocesss) struct maintains their state using the state member. This 16bit unsigned short that contains information that have been combined together using bitwise operations. You are required to use bitwise operators to change the states. Description High State Flags Field Name H U RD Bit number 15 14 13 12 Crit Unused (All

we investigate more theoretical method. To show that f(n) O(n), we want to find c such that f(n) cg(n) (for n is eventually large). To do this, we replace each term in f(n) by the dominant terms together with some relevant constant k. The choice of k is simply the sum of coefficients of all terms in f. For example, we want to prove 2n 5 O(n). We

Question 2 Write a program to measure the economy of countries by calculating their Growth Rate. If for a given period the GDP value at the beginning and subsequent year is known, calculate the Growth Rate (GR) of the country for each year, the Average Annual Growth Rate (AAGR) and the Compound Annual Growth Rate (CAGR). Also, measure the relative

Lets say we had a shop, MyShoppe, and wanted to prompt for the shop name. We would use shopName input(Please enter the shop name ) This will store the userentered shop name into the variable shopName. Lets prompt for the quantity of 2 items in the shop, a ring and glasses. ringQTYinput(Please enter ring QTY ) glassesQTY input(Please enter

You are a security researcher for your organization and it is your job to test software that other have authored. You have received a function that verifies entered passwords as a packaged program verify pass (along with its source code). This program takes two strings (passwords) and returns if those passwords are the same. The function will be

Test preconditions Ensure that you have the ASLR disabled. The output of the following command should be 0. cat procsyskernelrandomize va space If it is not, the run the following command echo 0 1 sudo, tee procsyskernelrandomize va space The toy problem here does not need the suid bit to be set but ensure that for Lab01Q2, suid bit is set (see

The input file The input file contains the size of the square matrix N (NbyN) in the first line. The subsequent lines each hold one matrix element. For example for the following matrix 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 the data is stored in the input file as follows 3 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 You may assume only valid input files are

Program Details The user will enter a date with their beginning checking account balance followed by the dates and values of debits and credits made to the account. The program will calculate the average endofday balance for the 30day period starting from the beginning balance date. The users first entry will be in the format mdyyyy numericbalance

The security assessment report (SAR) is a living document that is changed as required to reflect system, operational, or organizational changes. Modifications made to this document are recorded in the version history matrix below. At a minimum, this document will be reviewed and assessed annually. Reviews made as part of the assessment process

PROCESS OVERVIEW Step 6 MONITOR Security Controls Step 5 AUTHORIZE Information System Starting Point Step 1 CATEGORIZE Information System RISK MANAGEMENT FRAMEWORK (Repeat as Necessary) Step 4 ASSESS Security Controls Step 2 SELECT Security Controls Step 3 IMPLEMENT Security Controls

Problems Use the contents of Figure 2.1 to work Problems 1, 2 and 3. 1. Write the business rule(s) that govern the relationship between AGENT and CUSTOMER. 2. Given the business rule(s) you wrote in Problem 1, create the basic Crows Foot ERD. 3. Using the ERD you drew in Problem 2, create the equivalent object representation and UML class diagram.

Using the existing code to add additional cleaning logic to the clean_phone_numbers() function. Original Requirements 1. clean_phone_numbers ( ): Accepts a list of phone numbers and returns a list of phone numbers that contain precisely 10 digits. It removes any special characters from the numbers (parenthesis, hyphens) and removes any number that

index.py index.py ... 1 import phoney 2 import csv 3 4 5 6 7 8 9 10 11 12 13 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 X phoney.py 49 50 51 52 53 def presentmenu() This function presents a menu of options to the user and continues to request input until valid input is found. The

A company has three employee categories: salaried, wage and part-time. All employees have an employee ID number, name and SIN. Salaried employees have ID numbers starting with 0-4, whereas wage employee's IDs start with 5-7 and part-time employee's IDs start with 8-9. All employees are paid weekly and payment for each employee category is

Salaried GetPay() double ToString() string id string name string address string phone string sin long dob string dept string Employee Employee(id string, name string, address string, phone string, sin long, dob string, dept string) Getters) Setters() ToString() string salary double Salaried Salaried(id string, name string, address string, phone

The teacher wishes to see if her pupils can make sense of words in which certain letters have been removed. She requires a when space keypressed script that will take a word from the user and display a new word that is the same as the original except that each vowel has been removed. For clarification, the vowels should be considered as a, e, i, o

create matrices manually or randomly per instructions. You may need the following commands for Part C. The command rand (n) generates an n x n matrix of random numbers between 0 and 1 The command rand (m, n) generates an m x n matrix of random numbers between 0 and 1 The command randi (min, max, m, n) generates an m x n matrix of random integers

The following system of linear equations is called underdetermined because there are more variables than equations. x2x 3x3 4 2x1x2 4x3 3 Similarly, the following system is overdetermined because there are more equations than variables. x1 3x 5 2x1 2x 3 21 7x 0 You will explore whether the number of variables and the number of equations

2. (35 points) Effect of constraints on optimal solutions. A key result that optimal classifiers pick the most probable class, which defines Bayes optimality. One of the consequences is that optimal decisions are pure or crisp, they dont weight or mix decisions. But is this result always true Here we show how constraints can make the answer to

The web server answers requests sent by clients (e.g., web browsers) that run on various machines during the observation period. The main thing that a web server does is wait for a connection and then accept the connection to handle whatever request was sent. The name of the syscall to accept a connection is very intuitive. How many times does the

Python program that prints a multiplication table in the range that the user specifies. Allow the user to enter the lower and upper limit number. Calculate the products and print them in as a table. Hint: use tab spacings. We don't want any numbers to be printed twice, so just fill the top-right half of the table with asterisks. When your program

X x int(input (Enter the minimum number for the multiplication table )) 2 maximumnumber int(input (Enter the maximum number for the multiplication table )) 3 for i in range(minimumnumber, maximumnumber 1) HNM in lon o a 1 minimumnumber 4 5 6 7 8 9 10 for j in range (minimumnumber, maximumnumber 1) if j i print(, end t) print(i j, end t)

On the Communication Model diagram above, what element is indicated by the portion of the diagram labeled E Source Message Channel Receiver Noise,A Communication Model Doon Communic E A B Modol diagram m A D,Page 1 1 Page 2 2 Page 3 3 Page 4 4 Page 5 5 Quiz Information Previous Page Question 2 (4 points) A Source Message Channel Receiver Noise

1. In cell C5, enter a formula to generate a random integer between 1 and 100. Enter an IF formula into cell E5. If the number shown in C5 lies between 81 and 100, then it returns You win if the number lies between 51 and 80, then it returns Try again and if the number is less than 51 then it returns You lose Guido will arrive shortly to collect

Additional Requirements 1. Add the homework assignment header file to the top of your program. A description of your program will need to be included in the assignment header. This particular header can be added to your file by entering hhw while in command mode in vi. 2. Each of the example executions provided for your reference represents a

Distance between Bucharest to any cities Amsterdam 2280 Copenhagen 2250 Madrid Athens 1300 Dublin 2530 Milan Barcelona 2670 Glasgow 2470 Munich Belgrade 630 Helsinki 2820 Oslo Berlin 3950 Palermo 2590 Paris 1660 Prague 1800 Lisbon Bordeaux 2100 London Budapest 900 Lyon 3300 Rome 1750 Sofia 1600 Stockholm 2870 Vienna 1280 Warsaw 2970 1490 1140 390

The following is a plot of the number of transistors per integrated circuit over the period 1971 - 2008 takenfromhttps://ourworldindata.org/technological-progress (that site contains a lot of data, not just for technology). At first, this graph seems to show a steady progression until you look carefully at the y-axis ... it's not linear. Fromthe

Moores Law The number of transistors on integrated circuit chips (19712018) Moores law describes the empirical regularity that the number of transistors on integrated circuits doubles approximately every two years. This advancement is important as other aspects of technological progress such as processing speed or the price of electronic

write an algorithm (describe the steps) to calculate the total length of 3 highways Ontario. The three highways in Ontario are Highway 401, Highway 400, and Highway 407. Find the lengths of Highway 401, Highway 400, and Highway 407. Remember to Input the data. The expected output is an average of 3 highways. (It doesnt have to be an actual value,

Create two objects named a and b. Assign an integer value and a float value to them respectively. Print out the type of the float object, and the sum of the two objects. Exercise 2 Printing Write a few lines of code that prints out a tictactoe board. Expected output Exercise 3 Strings Create four string objects that take the values Arizona,

Management at Global Development Systems (GDS) asks for you to provide a report that will demonstrate and explain how the budget variance of the PMO Cloud Implementation Project will be analyzed, tracked and monitored. Management is also interested in using conditional formatting to tell if an information technology project is onbudget

Create a 3.html and a3.js files and link the two files. Your HTML page must not have any validation errors and should have a descriptive title, descriptive ids, and proper style. Part 1: Valid Positive Number Write the isValidPositiveNumber function Parameters: One string parameter that we will validate Operation: Check if the string will

Part 2 Movie Ticket Price Add a heading, output paragraph, and button to the HTML page. Create a function for the button to call that uses two prompts to ask a user how old they are (in years) and the title of the movie they want to see. If either value is invalid, we will display an error message. Use the function from part 1 to validate the age

Design a MultiFunction Arbitrary Waveform Generator. Problem Description You are tasked with design of function generator which can generate user defined waveform with following 1. Waveform Generation 1) Sine, square, triangle, sawtooth, and userdefined arbitrary waveforms. 2) Frequency range 1 Hz to 10 MHZ 3) Amplitude range 10 Vpp to 10 VRP. 4)

Create a menudriven python application with following menu options for users to run at the command line a. Generate Secure Password b. Calculate and Format a Percentage c. How many days from today until July 4, 2025 d. Use the Law of Cosines to calculate the leg of a triangle. e. Calculate the volume of a Right Circular Cylinder f. Exit program As

1. Given the following two functions f(n) 6n 4n 2 g(n)5n 9 Use LHopitals rule and limits to prove or disprove each of the following (g) 8 (f) 2. Rank the following functions from lowest asymptotic order to highest. List any two or more that are of the same order on the same line. 2n 10n 5 3n log n 4n 10 3n 2 n 6n 2 log n 2nn 6 3. Draw the

Q1. Answer the following questions based on the graph G below. If there are multiple nodes at the same level in the search tree, the node with the smallest label will be visited first before the other nodes. 0 3 6 2 5 7 Part a) Which node should we start the BFS algorithm from to have the minimum number of levels in the BFS tree traversal Explain

1. BFS and DFS (20 points) List the order of nodes that are visited in the following graph when performing the stated traversal. Assume that neighboring nodes are visited in alphabetical order. (20 pts) A C H F B D E G

What would be BFS and DFS traversal in below puzzle. Start at node A. ABC DE FG HIJ

Show the order of visit using DFS and BFS to traverse the following graph, starting at node 0 (this is a directed graph). When you have more than one node to choose from, always choose the smaller number. 3 6 2 7 5

List the nodes of the graph in the order in which they are visited using BFS traversal beginning at node 3. Separate each node by a comma and a space.,1) 2 3 5 4,1 2 0 3 5 List the nodes of the graph in the order in which they are visited using DFS traversal beginning at node 1. Separate each node by a comma and a space.

What is DFS and BFS traversal of graph Give the DFS and BFS traversal (starting with node 0) of graph. Show all intermediate steps 0 1 2 3 4 5

Identify a DFS traversal of the graph if the starting vertex is B. A B, E, A, C, D B, A, C, E, D B, A, D, C, E O B, C, E, A, D B D E

9 0 2 1 8 5 6,Most graph algorithms involve visiting each vertex in a systematic order. The two most common traversal algorithms are Breadth First Search (BFS) and Depth First Search (DFS). Implementation Use the Graph above, (Figure 2) to answer the following questions. 1. What type of graph is shown in Figure 2 2. Perform a Breath First Search

Make DFS and BFS starting from C node in the graph below.

D H B

write a Python program that traverses graphs in BFS and DFS manner. BFS will determine the shortest path distance (number of edges) from the root for each node reachable from the root. DFS will find cycles in the graph of nodes reachable from the root. Study the lecture on graphs, in particular graph traversals. Some helper code is provided. Don't

Let there is an undirected graph with 10 nodes with the following edges (x-y means x and y are connected): 1-2, 1-5, 1-7, 2-3, 2-5, 3-4, 3-5, 4-5, 4-10, 5-6, 6-7, 6-8, 6-9, 6-10, 7-8, 8-9, 9-10. Now, I. Express these relations as a graph. II. Apply BFS considering 1 as the source node (level-0 node). Draw the BFS tree and mark each level. If there

a. Write down the Adjacency matrix representation b. Write down the Adjacency List representation c. Generate the BFS tree using Queue d. Generate the DFS tree using Stack

3 5 0 7 2 6 4

To familiarize yourself with Jiffy, write a Jiffy program named addnum.jif (place it in the classresources folder) that prompts the user for two numbers and displays the sum of the two numbers. Run the main method in TestInterpreter and have it interpret addnum.jif to convince yourself that your program works as intended.

What is not a possible DFS traversel for this graph? Starting from Node A

E F B D

In this problem, we will consider what happens in stable matching when we are guaranteed additional structure on the preferences. (a) Suppose that there is a most popular man, whom all women rank first. Describe who this man must be matched with in every stable matching, and explain why. (b) Use your insight from the previous part to analyze the

Search the following graph using DFS and BFS, starting at node A A B D) F E

Imagine you are the emergency manager for your community. For Canadas annual Emergency Preparedness Week, your council has set a goal of having every household prepare an emergency kit. This kit would include enough water, food, and supplies to last for three days. Your job is to communicate this to the public. 1. What are some of the points you

Problem 1 Understanding of Discretization of Variables and Iterations Consider the summation of the square of a continuous function f(x) k y f(x) i1 where x is a vector of length k defined as a set of evenlyspaced values from a to b, i.e., in MATLAB we define xlinspace(a, b,k) and k1,2,3,..., etc. a) Develop a numerical solver (i.e., function) to

1. Find a catalog or visit the Web site of a major distributor of microcomputer equipment, such as Computer Discount Warehouse (www.cdw.com) or Dell (www.dell.com). Select or configure a system that provides optimal performance for the following types of users An accountant who uses office software, such as Microsoft Office, and statistical

Use the builtin MIN function in a formula in cell C2 to find the smallest value in cells B1, A2, and A1. The formula should start with A B 1 2 3 23 22 30 40 17 19 10 MING 20

For each of the following problems write the fundamental mathematical model to use, rearrange it to the form required to solve the problem, then solve the problem. Be sure to label appropriately. 1. A body falls freely from rest on Earth. Find a. its displacement at t 3s b. the time for it to reach a speed of 25 ms c. the time required for it to

A new generation of these processors have been announced by the vendors of each processor and due to microarchitecture innovations, each decreases its CPI by 25 ( CPI new CPIold 1.25), however due to the added complexity, each processor decreases it frequency by a percentage according to the inverse of 2X of the old CPI (Clock Freq new Clock

Suppose that we can improve the floatingpoint instruction performance of a machine by a factor of 15 (the same floatingpoint instructions run 15 times faster on this new machine). What percent of the instructions must be floating point to achieve a Speedup of at least 4 Suppose a program runs in 100 seconds on a machine, with multiply responsible

Write two programs to calculate the factorial of a given input integer in two ways a. Use a for loop b. Use recursion Your results variable must be an unsigned long long (64b). Test your programs and make sure they work. What is the maximum input value without causing an overflow (results needs to be correct) After testing your programs, you will

Prove your answer. a) If B C A, then AUB A. b) If PAU B 2PC, then PC maxPA, PB. c) If PAU B 2PC, then PC minPA, PB.

7 8 9 10 Use a calculator to evaluate each trigonometric ratio, to four decimal places. b) sec a) csc a) Determine an exact value for each expression. sintan 6 i) 7 6 i) ii) a) Determine an exact value for each expression. 4 5 COS tan 3 6 5T ii) cot tan 11 tan 6 1 sin tan 44 tan 4 a) Determine an exact value for each expression. 3n 4 3r 4 tan 5T

Task 2 Write a function bico(int n, int i) that returns the ith coefficient of binomial (x y). For example, bico(4,2) should return 6 because (x y) x 4xy 6xy 4zy y. CSCP 243002 Lab 11 Winter Quarter 2024 Seattle University The second coefficient of (x y) is 6. Notice that coefficient index starts from 0. Your program needs to receive two

Kathy has a small business selling apple cider at the farmers market. She pays 35 per day to rent her space at the market, and each cup of cider costs her 1. She sells the cider for 2.50 per cup and brings enough cider and cups to sell a maximum of 200 cups in a day. a) Write an equation to model each of the following for 1 day, as a function of

The algorithm for the cosine Taylors series expansion is given as follows (1)k1 x(2k2) (2k 2) x x4 x6 2 4 6 cos(x) 1 00 a) Create a user defined function to approximate the value of cosine (the algorithm above) using a whileloop to ensure that the algorithm runs until the relative error is below a given error tolerance (maxtol). A partially

a. How can the Naive Bayes algorithm be applied to the provided dataset to determine whether a football game should be conducted or cancelled, depending on the weather conditions (15 Marks) Outlook Temp (F) Humidity () Windy true sunny sunny sunny sunny sunny overcast overcast overcast overcast rain rain rain rain rain 75 80 85 72 69 72 8411 65 75

The following code calculates the mean of the entries in the uppertriangular part of a matrix A (that is, the mean of the entries aj for i j). Suppose A is a given m x n matrix. m, n size (A) SUM 0 COUNT 0 for i 1m for j end in SUM A(i, j) COUNT COUNT 1 SUM end AVG SUMCOUNT a. How many flops occur per pass through the inner for loop b.

Consider the problem on the Taylors series of the sine function. Modify (slightly) the MATLAB function sinetaylorN so that the whileloop checks both the error tolerance and the maximum number of iterations. In other words, the loop terminates when either the error is sufficiently small, or the maximum number of iterations is exceeded. a) Complete

b. What are the levels of the IV(s) c. What is the dependent variable d. Identify the control group, if any. e. Is the independent variable(s) a participant variable or a true manipulated variable WHY f. Draw the design including all labels. 18. Generate your own example of a 2 x 2 ANOVA experiment. a. What isare the independent variable(s) b.

Count the steps at each line of code, and write them out into their time complexity (t(n)), and estimate the Big O based on the time complexity. Code Snippet 1 input 9,6,4,1,7,2 n len (input) evennums oddnums totaleven 0 totalodd 0 for i in range(n) if inputi 2 0 evennums.append(inputi) totaleven 1 t(n) else oddnums.append(inputi)

Insert a table on this document showing the result set of Join a row of Table 1 with a row of Table 2 if the first letters are the same. Show all the rows of both tables, even if they do not have a matching row in the other table. Create the result table and state if this is a onetoone relationship in the mathematical sense or in the database

Define the variables a, b, c and d as a 12 b 5.6 C 3a 6 d (ab)c C dc Evaluate z e ln(cd ) C Z

When this machine starts up, you are logged in as the user sysadmin, with a home directory of homesysadmin. Type the commands below to be sure you see the same thing Ubuntu PC sysadminlocalhost pwd homesysadmin sysadminlocalhost ls Desktop Documents Downloads Music Pictures Public Templates Videos sysadminlocalhost ls Documents School Work

What was the actual value inside sum when we would expect 0.8 to have been assigned (refer to the hybrid 2 activity) Question 1 options C 0.8 C 0.7999999999999999 0.8888883209840987 C 0.80000000000000001

A couple decades ago, video games were developed fully, and released on a cartridge. Once that cartridge was finished, no bugs were ever getting fixed. As such, developers had to make sure they had a fully finished and polished result. Nowadays, it has become sadly common to release a game before it is done, and then update it with patches to

Consider the equation 3 cos2xsin x 1. (a) Write this equation in the form f(x)0, where f (x) psinxq sin xr. and p,q,rez. (b) Factorize f(x). (c) Write down the number of solutions of f(x)0, for 0x 2.

Convert the following number from decimal to the IEEE 32bit floating point. Show your work. Is this representation accurate Explain your answer. 57.310 (b) (12 points) Could you convert the decimal number 124.015625 into a single precision float without losing any precision from the original number Explain your answer.

Fill in the following table. For integers find their binary, octal, and hexadecimal representation in a 13bit computer using 2s complement. Show your work. Make sure your answer contains the correct number of bits. For Octal, fill leading unused bits with Os. Number 943 103 2,317 3,514 Binary 00011 1010 1111 Hex 0xFF99 or 0x1F99 Octal (Base 8)

4. What year was the Spiral model formally introduced A. 1982 B. 1963 C. 1988 D. 1977 5. Extreme Programming is a variation of what type of development A. Spiral B. Waterfall C. Agile D. Rational 6. Which is the most widely used agile process A. Lean B. Feature Driven Development C. Scrum D. XP

3. Another way to measure an angle is to compare the length of the arc that the angle sweeps out on a circle to the radius of the circle. That is radians arc length radius Using this information, complete the following (a) An angle of 1 radian in a circle of radius 4 cm will sweep out an arc length of cm. (b) An arc length of 10 m on a circle of

i) ii) What is the affix in Agta meaning become X What type of affix is it

Which interface asks a series of questions or conducts a dialogue with the user? Identify an advantage and disadvantage of the "menu drive" interface?

User InterfacesComputer Specifications Answers the following questions. Save the file as User Interfaces. Submit through the Canvas Submission page by the specified deadline. Bold and highlight your answers. What does the term User Interface mean 1. 2. 3. What are the four types of user interfaces mentioned in the Essential Concepts lecture